A maior rede de estudos do Brasil

Grátis
18 pág.
Impressão genômica

Pré-visualização | Página 1 de 1

IMPRESSÃO GENÔMICA
IMPRINTING GÊNICO
GENOMIC IMPRINTING
IMPRESSÃO GENÔMICAIMPRESSÃO GENÔMICA
(MAIS UMA EXCEÇÃO ...)
(FENÔMENOS EPIGEN(FENÔMENOS EPIGENÉÉTICOS)TICOS)
Fenômenos GenFenômenos Genééticosticos
z : ““HerdHerdááveisveis””
Monogênicos
(ou Mendelianos)
Complexos
(Multifatoriais:
Genes + Ambiente)
Associados à presença 
de genes 
(qualidade/quantidade)
Alterações Cromossômicas
(Numéricas , Estruturais)
O que é um gene?
z 5’...ATGCGATCGATGACGGATATTCAGCGCATCGATCATACGCGCATATCGCA
TCGTAGCATGCGCATCGATGCGACTCGCAGACTGCTCTAGCTCGTAGCATCGA
TGCATCGATCGAGCATCGATCTCGCATATCTAGTCATCGATCGATCGATCTAC
GTAGCTACGTAGCTCGTAGCTCGTAGATCGTACGTAGCTACGTACGTACGTCG
TACGTCAGTACGTCGTACGTCGTACGTCGTGCTCGTAGATCGTACGTCTGCTG
CTACGATACTATCGCGAGCATGCTCGATCGATCTCGTAGATCTCGATCTCGTC
GTACTAGCTGCTGCTCTCATCCGTACGTAGCTGCTAGTAGTACTGATTAATCGA
TCGTATATATATATATACGCGCGCGCGCGATATATATAATATACGCGACGTACG
TACGATGCATCGTATCTACTACGTAGCTACGATCGTAGCTAGCTGCTAGCTAC
GTAGCTAGCTAGCTAGCTGCTAGCTAGCTACGTACGTAGCTACGTACGTCGTC
GTCAGCATGCTAGCTACGTACGTGCATGCTAGATGCATG...3’
Como saber se uma seqComo saber se uma seqüüência de nucleotência de nucleotíídeos deos éé
um gene,um gene,
parte de um gene , parte de um gene , ouou
DNA sem funDNA sem funçção conhecida?ão conhecida?
ESTRUTURA BESTRUTURA BÁÁSICA DE UM GENESICA DE UM GENE
zz Os genes devem ter...Os genes devem ter...
Regiões regulatórias
(Promotores típicos*)
* Procariontes/Eucariontes
Regiões codificantes
“ORFs”
A seqA seqüüênciaência
de nucleotde nucleotíídeosdeos
indica as proteindica as proteíínasnas
posspossííveis ...veis ...
FENÔMENOS EPIGENÉTICOS
zz““EPIEPI””
Prefixo grego 
“em adição a ...”
“acima de ...”
“sobre...”
Ex.: Epidemia
(doença que recaem sobre o povo)
FENÔMENOS EPIGENÉTICOS
zz MODIFICAMODIFICAÇÇÕES NO FUNCIONAMENTO ÕES NO FUNCIONAMENTO 
DOS GENESDOS GENES
zz MECANISMOS DE REGULAMECANISMOS DE REGULAÇÇÃO GÊNICAÃO GÊNICA
SEM ALTERAR A SEQÜÊNCIA 
DE NUCLEOTÍDEOS
ADIÇÕES DE MOLÉCULAS SOBRE 
BASES do DNA OU PROTEÍNAS
PADRÃO MENDELIANO PADRÃO MENDELIANO 
PARA FUNCIONAMENTO DOS GENESPARA FUNCIONAMENTO DOS GENES
z UM PAR DE ALELOS DEFINE O 
FENÓTIPO ...
ALELO PATERNO E ALELO MATERNOALELO PATERNO E ALELO MATERNO
FUNCIONAM SIMULTANEAMENTEFUNCIONAM SIMULTANEAMENTE
QUANDO O LOCO ESTQUANDO O LOCO ESTÁÁ ATIVOATIVO
porque ....porque ....
IMPRESSÃO GENÔMICA
zz Durante a Durante a gametogêsegametogêse de mamde mamííferos feros 
ALGUNS GENES ALGUNS GENES 
(NÃO TODOS)(NÃO TODOS) RECEBEM RECEBEM ““MARCASMARCAS””
AS MARCAÇÕES (IMPRESSÕES) 
SÃO DIFERENTES PARA 
Ovogênese / Espermatogênese
AS MARCAÇÕES (IMPRESSÕES) 
NÃO MODIFICAM 
A SEQÜÊNCIA DE NUCLEOTÍDEOS DO DNA
IMPRESSÃO GENÔMICA COMO IMPRESSÃO GENÔMICA COMO 
EXCEEXCEÇÇÃO AO MODELO MENDELIANOÃO AO MODELO MENDELIANO
NA GENÉTICA CLÁSSICA (MENDELIANA) 
OS ALELOS EXERCEM A MESMA AÇÃO -
SEJAM HERDADOS DO PAI OU DA MÃE!
QUANDO EXISTE IMPRESSÃO QUANDO EXISTE IMPRESSÃO 
GENGENÉÉTICA NO LOCO, OS TICA NO LOCO, OS 
ALELOS FUNCIONAM SEGUNDO ALELOS FUNCIONAM SEGUNDO 
A ORIGEM PARENTAL.A ORIGEM PARENTAL.
Mecanismos de impressão genômica
COMO OCORRE?
zz O DNA PRESENTE EM DETERMINADA O DNA PRESENTE EM DETERMINADA 
REGIÃO (LOCO GÊNICO) REGIÃO (LOCO GÊNICO) ÉÉ MODIFICADO, MODIFICADO, 
INDEPENDENTE DA INFORMAINDEPENDENTE DA INFORMAÇÇÃO QUE ÃO QUE 
CONTENHACONTENHA (ALELOS DOMINANTES OU (ALELOS DOMINANTES OU 
RECESSIVOS).RECESSIVOS).
MECANISMO MAIS CONHECIDO:
METILAÇÃO DE BASES DO DNA
(ALGUMAS CITOSINAS TERÃO ADIÇÃO DE
UM GRUPO METIL)
Mecanismos de impressão genômica
POR QUANTO TEMPO PERMANECE?
NAS CÉLULAS GAMÉTICAS, AS 
“MARCAS” HERDADAS SEMPRE 
DESAPARECEM, 
ANTES QUE SE ESTABELEANTES QUE SE ESTABELEÇÇA A NOVA A A NOVA 
IMPRESSÃO!!!IMPRESSÃO!!!
PARA CÉLULAS SOMÁTICAS: 
DEPENDE DO LOCO
(ALGUNS “PARA SEMPRE”,OUTROS APENAS NO 
INÍCIO DO DESENVOLVIMENTO)
EXEMPLOS
QUANTOS E QUAIS LOCOS?QUANTOS E QUAIS LOCOS?
Número crescente ...
Vários exemplos de genes que
atuam no desenvolvimento e 
controle do ciclo celular ... 
EXEMPLOSEXEMPLOS
An epigenetic change alters the phenotype
without changing the genotype. As a result of
their unique genetic make-up, imprinted genes 
act as nodes of susceptibility for asthma, 
cancer, diabetes, obesity and many behavioral
and developmental disorders - a list that is 
surprisingly long given the limited number of
imprinted genes identified so far. 
JirtleJirtle andand WeidmanWeidman. Am . Am SciSci 95:14395:143--149 (2007)149 (2007)
EXEMPLOSEXEMPLOS
EXEMPLOSEXEMPLOS
SÍNDROME DE ANGELMAN
SÍNDROME DE PRADER-WILLY
EXEMPLOSEXEMPLOS
z SÍNDROME DE ANGELMAN
http://www.users.bigpond.com/websterpaul/KirstiesPage.htm
EXEMPLOSEXEMPLOS
Juan Carreno de Miranda,
1860 
(Museu do Prado) 
SSííndrome de ndrome de PraderPrader--WillyWilly
DeleDeleççãoão emem
15q1115q11--q13q13
CromossomoCromossomo
paternopaterno
D e l
eD e l
e çç ã
oã o
D e l
eD e l
e çç ã
oã o
N o
r m
a l
N o
r m
a l
N o
r m
a l
N o
r m
a l
DeleDeleççãoão emem
15q1115q11--q13q13
CromossomoCromossomo
maternomaterno
	Fenômenos Genéticos
	O que é um gene?
	 ESTRUTURA BÁSICA DE UM GENE
	FENÔMENOS EPIGENÉTICOS
	FENÔMENOS EPIGENÉTICOS
	PADRÃO MENDELIANO �PARA FUNCIONAMENTO DOS GENES
	IMPRESSÃO GENÔMICA
	Mecanismos de impressão genômica
	Mecanismos de impressão genômica
	EXEMPLOS
	EXEMPLOS
	EXEMPLOS
	EXEMPLOS
	EXEMPLOS
	EXEMPLOS