A maior rede de estudos do Brasil

Grátis
32 pág.
Aula 2- genes e DNA

Pré-visualização | Página 1 de 2

O que são os genes? 
Estrutura da molécula de DNA (ácido dessoxiribonucléico)
É um polímero (cadeia) de nucleotídeos.
4 tipos: 
Desoxiadenilato 
Desoxiguanilato
Desoxicitidilato
Desoxitimidilato
Nucleotídeos da molécula de DNA 
Grupamento fosfato
Carbohidrato: Pentose do tipo Desoxiribose
As bases nitrogenadas são diferentes.
3
Nucleotídeos da molécula de DNA
Poderemos chamá-los, em sala de aula, pelo nome das bases nitrogenadas: 
Adenina
Guanina
Timina 
Citosina
Como polimerizam?
Ligação fosfodiéster entre
nucleotídeos adjacentes
Ligação fosfodiéster 
O posicionamento do grupo fosfato e da hidroxila dá orientação à fita de DNA.
5´
3´
A molécula de DNA é composta por duas fitas nucleotídicas. 
As fitas se mantém unidas por pontes de hidrogênio entre as bases nitrogenadas A-T; C-G.
As fitas são antiparalelas.
Pontes de hidrogênio
8
Bases nitrogenadas
Purinas
Pirimidinas
9
Pontes de Hidrogênio
11
Representação da fita de DNA
5´GTGAGGGCTTTGCTCTCCTGGAGACATTTGCCCCCAGCTGTGAGCAGGGACAGGTCTGGCCACCGGGCCCCTGGTTAAGACTCTAATGACCCGCTGGTCCTGAGGAAGAGGTGCTGACGACCAAGGAGATCTTCCCACAGACCCAGCACCAGGGAAATGGTCCGGAAATTGCAGCCTCAGCCCCCAGCCATCTGCCGACCCCCCCACCCCGCCCTAATGGGCCAGGCGGCAGGGGTTGACAGGTAGGGGAGATGGGCTCTGAGACTATAAAGCCAGCGGGGGCCCAGCAGCCCTCAGCCCTCCAGGACAGGCTGCATCAGAAGAGGCCATCAAGCAGGTCTGTTCCAAGGGCCTTTGCGTCAGGTGGGCTCAGGGTTCCAGGGTGGCTGGACCCCAGGCCCCAGCTCTGCAGCAGGGAGGACGTGGCTGGGCTCGTGAAGCATGTGGGGGTGAGCCCAGGGGCCCCAAGGCAGGGCACCTGGCCTTCAGCCTGCCTCAGCCCTGCCTGTCTCCCAGATCACTGTCCTTCTGCCATGGCCCTGTGGATGCGCCTCCTGCCCCTGCTGGCGCTGCTGGCCCTCTGGGGACCTGACCCAGCCGCAGCCTTTGTGAACCAACACCTGTGCGGCTCACACCTGGTGGAAGCTCTCTACCTAGTGTGCGGGGAACGAGGCTTCTTCTACACACCCAAGACCCGCCGGGAGGCAGAGGACCTGCAGGGTGAGCCAACCGCCCATTGCTGCCCCTGGCCGCCCCCAGCCACCCCCTGCTCCTGGCGCTCCCACCCAGCATGGGCAGAAGGGGGCAGGAGGCTGCCACCCAGCAGGGGGTCAGGTGCACTTTTTTAAAAAGAAGTTCTCTTGGTCACGTCCTAAAAGTGACCAGCTCCCTGTGGCCCAGTCAGAATCTCAGCCTGAGGACGGTGTTGGCTTCGGCAGCCCCGAGATACATCAGAGGGTGGGCACGCTCCTCCCTCCACTCGCCCCTCAAACAAATGCCCCGCAGCCCATTTCTCCACCCTCATTTGATGACCGCAGATTCAAGTGTTTTGTTAAGTAAAGTCCTGGGTGACCTGGGGTCACAGGGTGCCCCACGCTGCCTGCCTCTGGGCGAACACCCCATCACGCCCGGAGGAGGGCGTGGCTGCCTGCCTGAGTGGGCCAGACCCCTGTCGCCAGCCTCACGGCAGCTCCATAGTCAGGAGATGGGGAAGATGCTGGGGACAGGCCCTGGGGAGAAGTACTGGGATCACCTGTTCAGGCTCCCACTGTGACGCTGCCCCGGGGCGGGGGAAGGAGGTGGGACATGTGGGCGTTGGGGCCTGTAGGTCCACACCCAGTGTGGGTGACCCTCCCTCTAACCTGGGTCCAGCCCGGCTGGAGATGGGTGGGAGTGCGACCTAGGGCTGGCGGGCAGGCGGGCACTGTGTCTCCCTGACTGTGTCCTCCTGTGTCCCTCTGCCTCGCCGCTGTTCCGGAACCTGCTCTGCGCGGCACGTCCTGGCAGTGGGGCAGGTGGAGCTGGGCGGGGGCCCTGGTGCGGCAGCCTGCAGCCCTTGGCCCTGGAGGGGTCCCTGCAGAAGCGTGGCATTGTGGAACAATGCTGTACCAGCATCTGCTCCCTCTACCAGCTGGAGAACTACTGCAACTAGACGCAGCCTGCAGGCAGCCCCACACCCGCCGCCTCCTGCACCGAGAGAGATGGAATAAAGCCCTTGAACCAGCCCTGCTGTGCCGTCTGTGTGTCTTGGGGGCCCTGGGCCAAGCCCCACTTCCCGGCACTGTTGTGAGCCCCTCCCAGCTCTCTCCACGCTCTCTGGGTGCCCACAGGTGCCAACGCCGGCCAGGCCCAGCATGCAGTGGCTCTCCCCAAAGCGGCCATGCCTGTTGGCTGCCTGCTGCCCCCACCCTGTGGCTCAGGGTCCAGTATGGGAGCTTCGGGGGTCTCTGAGGGGCCAGGATGGTGGGGCCACTGAGAAGTGACTTCTTGTTCAGTAGCTCTGGACTCTTGGAGTCCCCAGAGACCTTGTTCAGGAAAGGGAATGAGAACATTCCAGCAATTTTCCCCCCACCTAGCCCTCCCAGGTTCTATTTTTAGAGTTATTTCTGATGGAGTCCCTGTGGAGGGAGGAGGCTGGGCTGAGGGAGGGGGT 3´
Representação da fita de DNA
GTGAGGGCTTTGCTCTCCTGGAGACATTTGCCCCCAGCTGTGAGCAGGGACAGGTCTGGCCACCGGGCCCCTGGTTAAGACTCTAATGACCCGCTGGTCCTGAGGAAGAGGTGCTGACGACCAAGGAGATCTTCCCACAGACCCAGCACCAGGGAAATGGTCCGGAAATTGCAGCCTCAGCCCCCAGCCATCTGCCGACCCCCCCACCCCGCCCTAATGGGCCAGGCGGCAGGGGTTGACAGGTAGGGGAGATGGGCTCTGAGACTATAAAGCCAGCGGGGGCCCAGCAGCCCTCAGCCCTCCAGGACAGGCTGCATCAGAAGAGGCCATCAAGCAGGTCTGTTCCAAGGGCCTTTGCGTCAGGTGGGCTCAGGGTTCCAGGGTGGCTGGACCCCAGGCCCCAGCTCTGCAGCAGGGAGGACGTGGCTGGGCTCGTGAAGCATGTGGGGGTGAGCCCAGGGGCCCCAAGGCAGGGCACCTGGCCTTCAGCCTGCCTCAGCCCTGCCTGTCTCCCAGATCACTGTCCTTCTGCCATGGCCCTGTGGATGCGCCTCCTGCCCCTGCTGGCGCTGCTGGCCCTCTGGGGACCTGACCCAGCCGCAGCCTTTGTGAACCAACACCTGTGCGGCTCACACCTGGTGGAAGCTCTCTACCTAGTGTGCGGGGAACGAGGCTTCTTCTACACACCCAAGACCCGCCGGGAGGCAGAGGACCTGCAGGGTGAGCCAACCGCCCATTGCTGCCCCTGGCCGCCCCCAGCCACCCCCTGCTCCTGGCGCTCCCACCCAGCATGGGCAGAAGGGGGCAGGAGGCTGCCACCCAGCAGGGGGTCAGGTGCACTTTTTTAAAAAGAAGTTCTCTTGGTCACGTCCTAAAAGTGACCAGCTCCCTGTGGCCCAGTCAGAATCTCAGCCTGAGGACGGTGTTGGCTTCGGCAGCCCCGAGATACATCAGAGGGTGGGCACGCTCCTCCCTCCACTCGCCCCTCAAACAAATGCCCCGCAGCCCATTTCTCCACCCTCATTTGATGACCGCAGATTCAAGTGTTTTGTTAAGTAAAGTCCTGGGTGACCTGGGGTCACAGGGTGCCCCACGCTGCCTGCCTCTGGGCGAACACCCCATCACGCCCGGAGGAGGGCGTGGCTGCCTGCCTGAGTGGGCCAGACCCCTGTCGCCAGCCTCACGGCAGCTCCATAGTCAGGAGATGGGGAAGATGCTGGGGACAGGCCCTGGGGAGAAGTACTGGGATCACCTGTTCAGGCTCCCACTGTGACGCTGCCCCGGGGCGGGGGAAGGAGGTGGGACATGTGGGCGTTGGGGCCTGTAGGTCCACACCCAGTGTGGGTGACCCTCCCTCTAACCTGGGTCCAGCCCGGCTGGAGATGGGTGGGAGTGCGACCTAGGGCTGGCGGGCAGGCGGGCACTGTGTCTCCCTGACTGTGTCCTCCTGTGTCCCTCTGCCTCGCCGCTGTTCCGGAACCTGCTCTGCGCGGCACGTCCTGGCAGTGGGGCAGGTGGAGCTGGGCGGGGGCCCTGGTGCGGCAGCCTGCAGCCCTTGGCCCTGGAGGGGTCCCTGCAGAAGCGTGGCATTGTGGAACAATGCTGTACCAGCATCTGCTCCCTCTACCAGCTGGAGAACTACTGCAACTAGACGCAGCCTGCAGGCAGCCCCACACCCGCCGCCTCCTGCACCGAGAGAGATGGAATAAAGCCCTTGAACCAGCCCTGCTGTGCCGTCTGTGTGTCTTGGGGGCCCTGGGCCAAGCCCCACTTCCCGGCACTGTTGTGAGCCCCTCCCAGCTCTCTCCACGCTCTCTGGGTGCCCACAGGTGCCAACGCCGGCCAGGCCCAGCATGCAGTGGCTCTCCCCAAAGCGGCCATGCCTGTTGGCTGCCTGCTGCCCCCACCCTGTGGCTCAGGGTCCAGTATGGGAGCTTCGGGGGTCTCTGAGGGGCCAGGATGGTGGGGCCACTGAGAAGTGACTTCTTGTTCAGTAGCTCTGGACTCTTGGAGTCCCCAGAGACCTTGTTCAGGAAAGGGAATGAGAACATTCCAGCAATTTTCCCCCCACCTAGCCCTCCCAGGTTCTATTTTTAGAGTTATTTCTGATGGAGTCCCTGTGGAGGGAGGAGGCTGGGCTGAGGGAGGGGGT 
Quantos genes têm os humanos? 
50 a 100 mil genes
Genoma humano 3x109 - 108
3% do DNA humano corresponde a uma sequência gênica. E o resto? 
92% do DNA do baiacu são genes
Gene da insulina
GTGAGGGCTTTGCTCTCCTGGAGACATTTGCCCCCAGCTGTGAGCAGGGACAGGTCTGGCCACCGGGCCCCTGGTTAAGACTCTAATGACCCGCTGGTCCTGAGGAAGAGGTGCTGACGACCAAGGAGATCTTCCCACAGACCCAGCACCAGGGAAATGGTCCGGAAATTGCAGCCTCAGCCCCCAGCCATCTGCCGACCCCCCCACCCCGCCCTAATGGGCCAGGCGGCAGGGGTTGACAGGTAGGGGAGATGGGCTCTGAGACTATAAAGCCAGCGGGGGCCCAGCAGCCCTCAGCCCTCCAGGACAGGCTGCATCAGAAGAGGCCATCAAGCAGGTCTGTTCCAAGGGCCTTTGCGTCAGGTGGGCTCAGGGTTCCAGGGTGGCTGGACCCCAGGCCCCAGCTCTGCAGCAGGGAGGACGTGGCTGGGCTCGTGAAGCATGTGGGGGTGAGCCCAGGGGCCCCAAGGCAGGGCACCTGGCCTTCAGCCTGCCTCAGCCCTGCCTGTCTCCCAGATCACTGTCCTTCTGCCATGGCCCTGTGGATGCGCCTCCTGCCCCTGCTGGCGCTGCTGGCCCTCTGGGGACCTGACCCAGCCGCAGCCTTTGTGAACCAACACCTGTGCGGCTCACACCTGGTGGAAGCTCTCTACCTAGTGTGCGGGGAACGAGGCTTCTTCTACACACCCAAGACCCGCCGGGAGGCAGAGGACCTGCAGGGTGAGCCAACCGCCCATTGCTGCCCCTGGCCGCCCCCAGCCACCCCCTGCTCCTGGCGCTCCCACCCAGCATGGGCAGAAGGGGGCAGGAGGCTGCCACCCAGCAGGGGGTCAGGTGCACTTTTTTAAAAAGAAGTTCTCTTGGTCACGTCCTAAAAGTGACCAGCTCCCTGTGGCCCAGTCAGAATCTCAGCCTGAGGACGGTGTTGGCTTCGGCAGCCCCGAGATACATCAGAGGGTGGGCACGCTCCTCCCTCCACTCGCCCCTCAAACAAATGCCCCGCAGCCCATTTCTCCACCCTCATTTGATGACCGCAGATTCAAGTGTTTTGTTAAGTAAAGTCCTGGGTGACCTGGGGTCACAGGGTGCCCCACGCTGCCTGCCTCTGGGCGAACACCCCATCACGCCCGGAGGAGGGCGTGGCTGCCTGCCTGAGTGGGCCAGACCCCTGTCGCCAGCCTCACGGCAGCTCCATAGTCAGGAGATGGGGAAGATGCTGGGGACAGGCCCTGGGGAGAAGTACTGGGATCACCTGTTCAGGCTCCCACTGTGACGCTGCCCCGGGGCGGGGGAAGGAGGTGGGACATGTGGGCGTTGGGGCCTGTAGGTCCACACCCAGTGTGGGTGACCCTCCCTCTAACCTGGGTCCAGCCCGGCTGGAGATGGGTGGGAGTGCGACCTAGGGCTGGCGGGCAGGCGGGCACTGTGTCTCCCTGACTGTGTCCTCCTGTGTCCCTCTGCCTCGCCGCTGTTCCGGAACCTGCTCTGCGCGGCACGTCCTGGCAGTGGGGCAGGTGGAGCTGGGCGGGGGCCCTGGTGCGGCAGCCTGCAGCCCTTGGCCCTGGAGGGGTCCCTGCAGAAGCGTGGCATTGTGGAACAATGCTGTACCAGCATCTGCTCCCTCTACCAGCTGGAGAACTACTGCAACTAGACGCAGCCTGCAGGCAGCCCCACACCCGCCGCCTCCTGCACCGAGAGAGATGGAATAAAGCCCTTGAACCAGCCCTGCTGTGCCGTCTGTGTGTCTTGGGGGCCCTGGGCCAAGCCCCACTTCCCGGCACTGTTGTGAGCCCCTCCCAGCTCTCTCCACGCTCTCTGGGTGCCCACAGGTGCCAACGCCGGCCAGGCCCAGCATGCAGTGGCTCTCCCCAAAGCGGCCATGCCTGTTGGCTGCCTGCTGCCCCCACCCTGTGGCTCAGGGTCCAGTATGGGAGCTTCGGGGGTCTCTGAGGGGCCAGGATGGTGGGGCCACTGAGAAGTGACTTCTTGTTCAGTAGCTCTGGACTCTTGGAGTCCCCAGAGACCTTGTTCAGGAAAGGGAATGAGAACATTCCAGCAATTTTCCCCCCACCTAGCCCTCCCAGGTTCTATTTTTAGAGTTATTTCTGATGGAGTCCCTGTGGAGGGAGGAGGCTGGGCTGAGGGAGGGGGT 
Insulina
AMINOÁCIDO- PROTEÍNA
NUCLEOTÍDEO - DNA
Quem faz proteínas?
Onde estão localizados nas células? 
17
Processo de transcrição e tradução
Transcrição: transferência da informação do núcleo para o citoplasma por uma molécula de RNA. 
5’-ATGCTTGATGTAACACTG-3’
3’-TACGAACTACATTGTGAC-5’
5’-AUGCUUGAU