A maior rede de estudos do Brasil

Grátis
58 pág.
Aula 9 -Doencas geneticas e outros padroes de heranca

Pré-visualização | Página 2 de 3

eventual atraso na erupção dentária. 
Mal-formações cardíacas (50% morrem nos primeiros meses).
Nanismo mais comum na comunidade Amish.
Periodontite agressiva (AR) 11q14
Mutação no gene dipeptidil peptidase, remove dipeptitídeos de cadeia de proteína. 
Periodontite severa e cedo.
Destruição do osso alveolar.
Retração gengival.
Perda prematura de dentes.
A quantidade de microorganismos é inconsistente com a severidade da destruição e progressão da periodontite.
 
Outro tipo de periodontite agressiva foi mapeada no cromossomo 1q25.
Herança ligada ao X, ou sexual, dominante (SD)
Raquitismo hipofosfatêmico ligado ao X ou resistente à vitamina D (SD) Xp22.2 - Xp22.1
É o tipo de raquitismo mais comum. 
Gene mutado é o da fosfatase reguladora da endopeptidase: causa a má absorção intestinal do cálcio. Metabolismo anormal da vitamina D.
Os doentes possuem baixa estatura e raquitismo grave, hipofosfatemia com baixa reabsorção do fosfato nos rins, baixa concentração de vitamina D, dores ósseas, artrite degenerativa, calcificação de tendões, ligamentos e juntas.
Nos dentes, causa hipomineralização do esmalte, defeito da maturação da dentina, aumento da câmara pulpar, abcessos dentais recorrentes. 
Mulheres tem uma forma mais amena da doença.
Amelogênese imperfeita (SD) Xp22.3-p22.1
A mutação que causa a doença é uma deleção de 5kb do gene da amelogenina, que é o principal componente do esmalte do dente.
É clínica e geneticamente heterogênea.
Esmalte muito duro e fino
Dentes pequenos
Superfície do dente áspera
 Se não tratado, pode levar à perda dos dentes. 
Herança ligada ao X, ou ao sexo, recessiva (SR)
Displasia ectodérmica hipoidrótica (SR) Xq12-q13.1 
Causado pela mutação do gene da ectodisplasina A, uma proteína importante na sinalização da ectoderme e mesoderme, interação importante para o desenvolvimento das estruturas ectodérmicas. 
Ausência de suor, cabelos finos e frágeis, rarefação de pelos. Lágrimas, saliva e unhas normais.
 Hipodontia. 
Incontinência pigmentar ou Bloch-Sulzberger (SR) Xq28 
Mutação no gene NEMO, que regula complexo de proteínas (fatores de transcrição) que previnem a apoptose de algumas células. A mutação é causada por um rearranjo do gene NEMO. 
Possuem lesões vesiculares na pele ao nascer. Com mais idade, a pigmentação se torna irregular devido depósito de melanina e a deposição de pigmento na matriz (não nos melanócitos).. 
Incontinência pigmentar ou Bloch-Sulzberger (SR) Xq28
Perda de cabelo , problemas visuais e ausência de dentes ou dentes conóides. 
Convulsões.
Em geral, aparece em heterozigoze nas meninas. Na maioria dos casos é letal nos homens.
Repetições de trinucleotídeos - TRED
TRED tipo 1: são expansões de trinucleotídeos na região codificante (todos são poliglutamina).
TRED tipo 2: são expansões de trinucleotídeos na região não-codificante, próxima da região codificante. 
Repetições trinucleotídica
Doença de Huntington
Gene com 67 éxons com 170 mil pares de bases que codifica uma proteína de 3.144 aminoácidos, denominada proteína huntingtina. Os doentes possuem um alelo (AD) com 36-180 repetições. Quanto maior o número de repetições, mais grave é a doença e esta aparece de forma mais precoce (antecipação).
Repetições trinucleotídicas
 Distúrbio cerebral e motor progressivo por morte das células cerebrais. Alterações na fala, personalidade, caminhar bambo, movimentos espamódicos incontroláveis. Nos últimos estágios, os pacientes ficam mudos, sem cognição e imóveis, em posições contorcidas (articulações rígidas). Podem sobreviver por 30 anos após o surgimento da doença, mas geralmente sobrevivem por 15 a 20 anos.
Em camundongos, a huntingtina com glutaminas extras se aglomeram nas células (similar a Alzheimer). 
Qual o efeito das poliglutaminas? formação de agregados por dobramento errôneo, ou ser neurotóxica, ou inibem via de degradação proteolítica ou induzem a morte celular programada, ou gera escassez de glutaminas livres, diminuindo o glutamato que pode ocasionar a morte neuronal. 
Repetições trinucleotídica
Distrofia miotônica
Gene codificante de uma quinase (AD).
Com efeito de antecipação. 
As doenças causadas por cromossomos de origem maternas são mais 
precoces e graves (espermatozóides com grandes expansões não são 
viáveis).
Distrofia miotônica (AD) 19q13.3
é a doença neuromuscular hereditária mais comum em adultos
Fraqueza e perda muscular lenta e progressiva, começando na face (ptose palpebral, fraqueza mandibular e do esternocleidomastóideo) causando falta de expressão facial e miotonia (contração ativa contínua dificultando o relaxamento). 
Retardo mental leve e atraso no desenvolvimento motor. 
Defeitos no músculo cardíaco. 
Repetições trinucleotídicas 
Síndrome do X frágil
Gene FMR1 (exportação do mRNAs, regulando a tradução em células cerebrais). 
Metilação da região não traduzida afeta a transcrição deste gene. 
Penetrância baixa em mulheres por causa da inativação do X (30% contra 80% nos homens), porém é um alelo dominante. 
Síndrome do X frágil 
Retardo mental e motor de moderado a grave, aspectos autistas e comportamento hiperativo. 
Evita contato tátil e visual, mordem as mãos, fala vacilante e repetitiva, abanam os braços e mãos.
Não diagnosticada ao nascer. 
Síndrome do X frágil (SD)
Homens com pré-mutação possuem de 50 a 230 cópias. Filhas destes homens sofrem expansão da sequência (que só ocorre nas mulheres – células gaméticas) e que é transmitido aos filhos. 
Herança ligada ao Y ou holândrica
23 genes na região não pseudo-autossômica: genes holândricos.
Azoospermia ou Oligospermia Yq11.2. Proteína de processamento de RNA ou de controle traducional no início da espermiogênese, expressa especificamente nos testículos.
Limitados pelo sexo
São determinadas por genes autossômicos que afetam função ou estrutura presente em apenas um dos sexos. 
- Hiperplasia adrenal congênita ou síndrome adrenogenital, causa virilização de meninas.
- Hipoganadismo e puberdade precoce (4 anos de idade) afeta meninos.
Influenciado pelo sexo
Genes autossômicos que se comportam com dominante em um sexo e como recessivo em outro. 
Calvície e hemocromatose hereditária
Herança polialélica
ATGGGTAGCCCTGTAAGGGCACGTAG
ATGGGTAGCCGTGTAAGGGCACGTAG
ATGGGTAGCCCTGTAAGGGTACGTAG
ATGGGTCGCCCTGTAAGGGCACGTAG
ATGGGTAGCCCTGTAAGGGAACGTAG
Alelo 1 – 65%
Alelo 2 – 13%
Alelo3 – 6%
Alelo 4 – 15%
0,7%
O número de diferentes genótipos é [n(n+1)]/2, onde n é o número de alelos. 
E o número de fenótipos?
Herança mitocondrial
37 genes nas mitocôndrias responsáveis pela respiração celular e algumas funções básicas (22 tRNAs e 2 rRNA)- pelo menos 66 proteínas são codificadas no núcleo e transportadas para dentro da mitocôndrias.
Cada célula contém centenas de mitocôndrias e cada mitocôndria. 
O ovócito possui aproximadamente 100.000 mitocôndrias. Grande número é perdido e supõe-se que permaneçam entre 10 a 100. 
Heredograma herança mitocondrial
Quando uma célula se divide, as células filhas recebem proporções diferentes de cromossomos mitocondriais normais e mutantes.
Tecidos com mitocôndrias com genes mutantes possuem capacidade de geração de energia alterados. Também há alterações com a idade. 
Afeta tecidos com grande demanda de energia – SNC, coração, músculo esquelético, rins, fígado, olhos, ouvido, sangue e produtores de hormônio. 
Doenças mitocondriais – genes obtenção de energia
Neuropatia ótica hereditária de Leber (LHON). Causa cegueira por degeneração do nervo óptico e dos neurônios da retina (início da doença aos 20 anos). As vezes é acompanhada por neurodegeneração – nervos periféricos, perda de tonicidade muscular, problemas cardíacos. 
Síndrome de Leigh – distúrbio fatal no início da infância pois o cérebro, músculos, olhos e pulmões são afetados.
Doenças mitocondriais- genes estruturais
Miopatia mitocondrial – degeneração das fibras musculares e resultam em grave