Aula 11   Bioinformatica

Aula 11 Bioinformatica


DisciplinaBiociências: Biologia Celular e Bioquímica248 materiais3.761 seguidores
Pré-visualização1 página
Bioinformática 
Montagem de sequencias 
\uf02a Para obter o resultado completo de um 
sequenciamento é necessário: 
1. Fragmentar a sequencia de interesse em milhares/milhões 
de pequenos segmentos. 
2. Ler a sequencia de cada fragmento (sequenciamento). 
3. Com a bioinformática sobrepor cada um destes fragmentos 
com sequencias idênticas. 
4. Sobrepor sequencias maiores até determinar a sequencia 
completa. 
 
Como montar sequências pós-
sequenciamento? 
\uf02a O sequenciamento é dado pela análise de vários fragmentos. 
 
\uf02a O sequenciador apenas excita com laser os nucleotídeos 
marcados com fluoróforos ou outra tecnologia. 
 
\uf02a Então como transformar a luz emitida pelos nucleotídeos 
em uma informação (ATCG)? 
Como construir uma sequência a 
partir dos dados do sequenciamento 
\uf02a Aplicação de modelos 
matemáticos e 
computacionais para o 
estudo da informação 
biológica. 
Bioinformática 
\uf02a Utilização de ferramentas computacionais para 
estudo de genomas. 
 
\uf02a Uso de algoritmos para resolver problemas 
complexos e específicos: 
\uf02a Genômica Estrutural 
\uf02a Genômica Funcional 
\uf02a Genômica Comparativa 
Bioinformática 
\uf02a Após o sequenciamento, os resultados saem na forma de 
eletroferogramas. 
Montagem de sequências 
\uf02a Estes dados são inseridos em programas de Base Calling. 
 
\uf02a Consiste no processo de leitura dos dados do sequenciador, 
identificação da sequência gerada e atribuição de um valor de 
qualidade para cada base gerada. 
 
\uf02a O programa mais utilizado é o PHRED. 
Montagem de sequências 
\uf02a Softwares: 
\uf02a Phred: identificação de bases nitrogenadas (nucleotídeos) e 
atribui valores de qualidade. 
Bioinformática 
\uf02a Softwares: 
\uf02a Phred: análise dos picos X linha de base X distância entre os picos. 
 
Bioinformática 
\uf02a Softwares: 
\uf02a Phred: converte a sequência em arquivo FASTA 
Bioinformática na Genômica 
Estrutural 
S
ím
b
o
lo
 F
A
S
T
A
 
Geninfo 
Identifier 
Número 
de acesso Descrição da sequência/Gene/Organismo 
Sequência de DNA depositada 
Bioinformática 
\uf02a Caso tenha sido utilizado 
o sequenciamento 
Shotgun, além da 
sequência-alvo também 
foi sequenciado as 
regiões do plasmídeo 
flanqueadoras. 
 
\uf02a A retirada destas regiões 
é geralmente realizada 
pelo uso do programa 
Cross-Match. 
\uf02a Softwares: 
\uf02a Cross-Match: identificação de sequências do vetor na amostra 
sequenciada 
 
Bioinformática na Genômica 
Estrutural 
vetor vetor inserto 
Sequenciamento 
Primer Primer 
(1) 
(2) 
(3) Amostra sequenciada 
Cross-Match 
(4) Amostra sequenciada 
\uf02a Softwares: 
\uf02a Cross-Match: compara sequências em arquivo FASTA. 
\uf02a Mascara a contaminação com sequências do vetor inserindo um 
\u201cX\u201d no local onde encontra bases nitrogenadas (nucleotídeos) 
contaminantes. 
Bioinformática 
>Seq1 
XXXXATGCGCATAGCATAGGGACATCATACATTTTACACACAAGAGACAGACGAT 
ACTACATGTCATGACTACXXXXXXXXXXXXXXX 
 
Exemplo de saída do cross_match 
\uf02a Após a geração de arquivos sem contaminantes, contendo 
a identificação dos nucleotídeos e os valores de qualidade 
a análise segue pela montagem das sequencias maiores. 
 
\uf02a O programa geralmente empregado é o Phrap que utiliza 
o mecanismo de sobreposição (alinhamento). 
Montagem de Sequências 
\uf02a Softwares: 
\uf02a Phrap: Montagem de sequências contiguas (contigs) 
Bioinformática 
Alinhamento de sequências 
sequenciadas 
\uf02a Vários fragmentos sequenciados são sobrepostos 
 
\uf02a Ao conjunto de contigs é dado o nome de reads. 
 
\uf02a Quando todos os reads são corretamente alinhados em uma 
sequência consenso (Scaffold), temos o genoma completo. 
Alinhamento de sequências 
sequenciadas 
Sequência sobreposta sem alinhamento 
Sequência sobreposta com alinhamento 
\uf02a Softwares: 
\uf02a Consed: análise e edição dos contigs. 
Bioinformática 
\uf02a Softwares: 
\uf02a Scaffold: fechamento 
dos gaps 
Bioinformática 
Comparação de Sequências 
\uf02a Tem o objetivo de identificar 
SEMELHANÇAS/DIFERENÇAS entre sequências de 
DNA, RNA e de Proteínas. 
Alinhamento de Sequências 
\uf02a Objetivos 
\uf02a 1. Medir a 
similaridade entre 
duas ou mais 
sequências 
\uf02a 2. Inferir relações 
evolucionárias 
\uf02a 3. Observar padrões 
de conservação e 
variabilidade para 
predições estruturais 
e funcionais. 
Comparação de Sequências 
\uf02a O método tradicional de comparar sequências consiste no 
alinhamento. 
\uf02a Comparar duas ou mais sequencias buscando similaridades. 
Tipos de Alinhamento 
\uf02a Alinhamento Global 
\uf02a Compara sequências em toda sua extensão; 
\uf02a Espera-se semelhanças por toda a extensão da sequência; 
\uf02a Programas: ClustalW 
Alinhamento Local 
\uf02a Alinhamento Local 
\uf02a Encontra o melhor alinhamento de algum segmento de uma 
sequência contra o segmento de outra; 
\uf02a Programas: BLAST 
Comparando alinhamento global X local 
 
Alinhamento local no Blast 
Sequência alvo 
Sequência 
referência 
1. Identidade: Quantos idênticos; 
2. Similaridade: Quantos parecidos, considera a possibilidade do alinhamento 
ter acontecido ao acaso; 
3. Homologia: Relação evolutiva entre duas sequências, ou seja: se tem 
ancestral comum. 
Comparação de Sequências 
\uf02a Valores de Qualidade no \u201cAlinhamento\u201d 
> GTCGATCGATCGAGCTAGCTAGCTA 
 > ATTGATCCAGCT - GCTAGAT 
- Match: Correspondência correta entre pares de resíduos; 
- Mismatch: Falso alinhamento; 
- Gap: Sequência de espaços no alinhamento; 
Pontuação do Alinhamento 
\uf02a O melhor alinhamento entre duas sequências: 
 
 
 
 
\uf02a Será dado por um Score que á soma da associação das 
pontuações de cada nucleotídeo alinhado de acordo com um 
critério pré-definido. 
Score do alinhamento 
G A \u2013 C G G A T T A G 
G A T C G G A A T A G 
\uf02a Somando o Score deste alinhamento. 
Score do Alinhamento 
G A \u2013 C G G A T T A G 
G A T C G G A A T A G 
\uf02a Somando o Score deste alinhamento. 
\uf02a Match: 9 x 1 
\uf02a Mismatch: 1 x (-1) 
\uf02a Gap: 1 x (- 2) 
\uf02a Gap extension: -5 
 Score: [ (9 x 1) + (1 x (-1)) + (1 x (-2))] = 6 
 
Matriz de Substituição 
\uf02a Matriz de Score utilizam as pontuações do alinhamento de 
proteínas para medir a distância genética (divergência). 
\uf02a GRIFFITHS A. J.F. et al. Introdução à Genética, 10 ed., 
Rio de Janeiro: Guanabara Koogan, 2013, 422-441. 
 
\uf02a http://www2.bioqmed.ufrj.br/prosdocimi/FProsdocimi
07_CursoBioinfo.pdf. 
Referência