Sigma Aini

Prévia do material em texto

BACTERIAL AND PHYTOPLASMA DISEASES
A TonB-dependent transducer is responsible for regulation
of pathogenicity-related genes in Xanthomonas axonopodis pv. citri
Luqman Qurata Aini • Hisae Hirata •
Shinji Tsuyumu
Received: 23 November 2009 / Accepted: 3 January 2010 / Published online: 23 February 2010
� The Phytopathological Society of Japan and Springer 2010
Abstract The TonB-dependent transducer is required for
plant pathogenicity in several plant pathogenic bacteria. In
this study, we investigated the role of a putative TonB-
dependent transducer, XAC4131, in Xanthomonas axo-
nopodis pv. citri, the causal agent of citrus canker disease.
A mutation in the XAC4131 gene caused a delay in the
elicitation of the hypersensitive reaction in tobacco leaves.
However, the pathogenicity in citrus leaves was similar to
that of wild type. In hrp-inducing medium, XAC4131
controlled the expression of the hrp regulatory gene hrpG.
Also, XAC4131 was involved in expression of the adjacent
genes rpoEXAC4129 and XAC4130, which encode
RpoE(XAC4129) and FecR-like protein, respectively. The
results suggest that XAC4131 controls the expression of
hrpG indirectly, probably via rpoEXAC4129 and XAC4130.
Furthermore, we also demonstrated that transcription of
rpoEXAC4129, XAC4130 and XAC4131 seems to be regu-
lated by the Fur protein.
Keywords Citrus canker � HR � hrp �
Hypersensitive reaction � TonB-dependent transducer �
Xanthomonas axonopodis pv. citri
Introduction
Xanthomonas axonopodis pv. citri (Xac) causes severe
damage in citrus plants by eliciting cankers that develop on
their leaves, twigs, shoots, and fruits (Brunings and Gabriel
2003; Graham et al. 2004). The availability of the complete
genome sequence of Xac strain 306 has greatly facilitated
the analyses of virulence factors of Xac (da Silva et al.
2002). Many of the genes are thought to be associated with
pathogenicity, but the function of only a few has been
experimentally verified (Brunings and Gabriel 2003; da
Silva et al. 2002). PthA and its homologues have been
shown to be a major factor in Xac for elicitating necrotic
cankers on citrus (Al-Saadi and Gabriel 2002; Duan et al.
1999; Kanamori and Tsuyumu 1998; Swarup et al. 1991,
1992).
TonB-dependent receptors (TBDRs), comprising a
receptor protein family, are assembled in the outer mem-
brane of Gram-negative bacteria. Most TBDRs function in
the transport of iron and the uptake of iron–siderophore
complexes and vitamin B12 (Braun 1995, 1997; Moeck and
Coulton 1998; Sennett et al. 1981), and some of the TBDRs
play important roles in plant pathogenicity. For example,
PrhA, a TBDR in Ralstonia solanacearum, is involved in
hypersensitive reaction (HR) induction as well as in the
pathogenicity of R. solanacearum (Marenda et al. 1998). A
protein encoding a putative siderophore receptor, which
has 29% identity to PrhA of R. solanacearum, can be found
in X. oryzae pv. oryzicola (Xoc). Mutation in this prhA
homolog was reported to lead to a loss in the ability to
L. Q. Aini � S. Tsuyumu
Graduate School of Science and Technology,
Shizuoka University, 836 Ohya, Suruga-ku,
Shizuoka 422-8529, Japan
H. Hirata � S. Tsuyumu (&)
Faculty of Agriculture, Shizuoka University,
836 Ohya, Suruga-ku, Shizuoka 422-8529, Japan
e-mail: tsuyumu@agr.shizuoka.ac.jp
S. Tsuyumu
Institute for Genetic Research and Technology,
Shizuoka University, 836 Ohya, Suruga-ku,
Shizuoka 422-8529, Japan
Present Address:
L. Q. Aini
Faculty of Agriculture, Brawijaya University,
Jl. Veteran, Malang 65145, Indonesia
123
J Gen Plant Pathol (2010) 76:132–142
DOI 10.1007/s10327-010-0227-4
elicit HR in tobacco and pathogenicity in rice (Zou et al.
2006). A TBDR protein in X. campestris pv. campestris
(Xcc), XCC3358, also has been reported to be involved in
pathogenicity and sucrose transport (Blanvillain et al.
2007).
Koebnik (2005) proposed that the TonB-dependent
transducer is a subclass of TBDR involved in the so-called
trans-envelope signal transduction system. TonB-depen-
dent transducer has a unique N-terminal extension in its
mature protein that interacts with its cognate anti-sigma
factor protein family. They are encoded by genes that are
either in a cluster or close to each other in the genome
(Koebnik 2005). One member of the TonB-dependent
transducer is PrhA, which also controls the expression of
the hrp regulatory cascade together with PrhR, an anti-
sigma factor family protein, and PrhI, a sigma factor family
protein in R. solanacearum (Brito et al. 1999, 2002;
Marenda et al. 1998). Using a hidden Markov model
(HMM) (Eddy 1996) generated from the N-terminal
extension that is unique to the subclass of TonB-dependent
transducers, Koebnik (2005) predicted the presence of the
gene for TonB-dependent transducers in the genomes of
208 eubacterial species including Xac. In the genome of
Xac strain 306, two predicted TonB-dependent transducers,
XAC4131 and CirA, were found (Koebnik 2005). CirA, a
ferric iron-catecholate outer membrane transporter, is
known to be involved in iron utilization in Escherichia coli
(Nikaido and Rosenberg 1990), but the function of
XAC4131 in Xac remains unknown. From the character-
ization of XAC4131, we show in the present study that it is
involved in HR induction through the control of hrp
regulatory gene expression at the transcriptional level.
Materials and methods
Bacterial strains, plasmids and culture conditions
Bacterial strains and plasmids used in this study are listed
in Table 1. Xac strains were grown at 27�C in YP medium
(1% peptone, 0.5% yeast extract, pH 6.8), or in hrp-
inducing medium XVM2 (Wengelnik et al. 1996). Esche-
richia coli strains were grown in Luria–Bertani broth (1%
tryptone, 0.5% yeast extract, 0.25% NaCl, pH 7.0) at 37�C.
When required, antibiotics were added at the following
concentrations: rifampicin 150 lg/ml, gentamycin 15 lg/
ml, ampicillin 100 lg/ml, kanamycin 30 lg/ml, and
streptomycin 30 lg/ml.
Recombinant DNA techniques
Most recombinant techniques such as preparation of plas-
mid and chromosomal DNAs, polymerase chain reaction
(PCR), restriction endonuclease digestion, gel electropho-
resis, DNA ligation, and Southern blot hybridization were
done as described previously (Ausubel et al. 1996; Sam-
brook et al. 1989). Most of the restriction and modification
enzymes used in this study were purchased from Nippon
Gene (Tokyo, Japan) and New England Biolabs (Beverly,
MA, USA). The sequencing reactions were performed
using a CEQTM 2000XL DNA Analysis System (Beckman
and Coulter, Fullerton, CA, USA) according to the manu-
facturer’s directions.
Construction of Xac mutants
Xac mutants were constructed using double homologous
recombination with the suicide vector pJQ200SK, which
harbors the sacB gene as a counterselection marker. To
create a deletion mutant of XAC4131, primers left-
XAC4131-F-SpeI (50-ACTAGTGTGCAGAAGTCAG
CACTGCAGGCACCA-30) and leftXAC4131-R-HindIII
(50-AAGCTTTCAGTTCTGCGCTGGCAGCTTGCCGAT
GTCTTC-30) (the underlined sequences represent the
restriction site of SpeI and HindIII, respectively; boldfaced
sequence represents the additional stop codon) were used
to amplify an 838-bp fragment containing 262 bp of the
upstream region and the first 576 bp of the ORF region of
XAC4131. Primers rightXAC4131-HindIII (50-AAGCTT
GTCAACGAAGTGAGCTGGGATTACTACCCC-30) and
rightXAC4131-BamHI (50-GGATCCGTAGGAATTCTG
CAGGTCGGCGCTGTT-30) (the underlined sequences
represent the restriction site of HindIII and BamHI,
respectively) were used to amplify the 927-bp internal
region of XAC4131. These two amplified fragments were
cloned into the pGEM-T Easy vector (Promega, Madison,
WI,USA) to generate pGL and pGR, respectively. pGL
was digested using SpeI and HindIII, and the resultant
fragment was ligated into the same site in pGR, to generate
pGdel4131. The recombinant fragment in pGdel4131
comprises a 462-bp internal deletion of the XAC4131 ORF
(154 amino acid). The recombinant fragment also con-
tained an additional stop codon (TGA) and a new restric-
tion site, HindIII, after the first 576 nt of the ORF. This
recombinant fragment was further confirmed by
sequencing.
After digestion of pGdel4131 using SpeI and BamHI, the
recombinant fragment was ligated into the same site on
suicide vector pJQ200SK to generate pJdel4131 to trans-
form E. coli S17-1(kpir) cell. The pJdel4131 was intro-
duced into the Xac NA-1 strain by biparental mating. A
marker-exchanged mutant was obtained by double
homologous recombination using the sucrose selection
marker (sacB) as previously reported (Kaniga et al. 1991).
The deletion mutant, DXAC4131, was confirmed by PCR
amplification and sequencing.
J Gen Plant Pathol (2010) 76:132–142 133
123
A nonpolar in-frame deletion mutant of the fur gene was
constructed by deleting 291 internal nucleotides of the fur
gene using the splicing by overlap extension (SOE) tech-
nique as described previously (Horton et al. 1990; Lefebvre
et al. 1995; Matsumoto et al. 2003). Briefly, primers 1517-
left-F (50-ACTAGTTCTTGTCGCGTGCCAGGTTG-30)
and 1517-left-R (50-TACAGCACCAGCGAGTGCTCGC
TCTTCTGTTCGAGCAGTTCC-30) were used to amplify
a 565-bp fragment containing 490 bp of the upstream
region and the first 75 bp of the fur ORF region. Primers
1517-right-F (50-GGAACTGCTCGAACAGAAGAGCG
AGCACTCGCTGGTGCTGTA-30) and 1517-right-R
(50-ACTAGTGGTGGTGTGGAAGTGAGCAAGGA-30)
(the underlined sequence represents the restriction site of
SpeI) were used to amplify a 491-bp fragment containing
45 bp of the rest of the internal region and 446 bp of the
downstream region of the fur ORF.
The two fragments were then purified from the bands
resulting from agarose gel electrophoresis and subjected to
a second PCR-based SOE using primer pair 1517-left-F
and 1517-right-R. The resultant fragment comprised an
in-frame deletion of 291 bp (97 amino acids) of the fur
internal region. This fragment was cloned in pGEM-T Easy
and confirmed by sequencing. After digestion with SpeI,
this fragment was ligated into the same site of pJQ200SK
to create pJdelfur and to transform E. coli S17-1(kpir)
cells. The pJdelfur was conjugated into Xac NA-1 strain by
biparental mating. A marker-exchange mutant was
obtained by double homologous recombination as previ-
ously reported (Kaniga et al. 1991). The deletion mutant
Table 1 Bacterial strains and plasmids used in this study
Strains/plasmids Relevant characteristics Reference/
source
Escherichia coli
DH5a F-, endA1, hsdR17(rk? mk-), supE44, thi-1, recA1, gyrA96, relA1, u80dlacZDM15D (lacZYA-
argF)U169
BRL Co.
S17-1(kpir) Tpr Smr, recA, thi, pro, hsdR- M?RP4: 2-Tc:Mu-Km:Tn7, kpir Biomedal
Xanthomonas axonopodis pv. citri
NA-1 Isolated from Citrus natsudaidai, spontaneous rifampicin-resistant mutant Laboratory
collection
NA-1(pUFR047) NA-1 harboring empty vector pUFR047, Rifr, Gmr This study
NA-1(pG*) NA-1 harboring pG*, Rifr, Gmr Yamazaki et al.
2008
DXAC4131 XAC4131 deletion mutant of NA-1, Rifr This study
DXAC4131(pUFR047) DXAC4131 harboring empty vector pUFR047, Rifr, Gmr This study
DXAC4131(pG*) DXAC4131 harboring pG*, Rifr, Gmr This study
DXAC4131(pcXAC4131) DXAC4131 harboring pcXAC4131 This study
Dfur fur deletion mutant of NA-1, Rifr This study
Plasmids
pGEM-T Easy T-A Cloning vector, lacZ, Apr Promega
pUFR047 Broad-host-range vector, Gmr de Feyter et al.
1993
pJQ200SK Suicide vector, Gmr Quandt and
Hynes 1993
pG* hrpG* with its native promoter in pUFR047 Yamazaki et al.
2008
pGL 838-bp fragment containing upstream region and the first 576 bp of ORF region of XAC4131 with
premature stop codon in pGEM-T Easy
This study
pGR 927-bp internal region of XAC4131 in pGEM-T Easy This study
pGdel4131 1.7-kb fragment with premature stop codon and 462-bp deletion of XAC4131 in pGEM-T Easy This study
pJdel4131 1.7-kb fragment with premature stop codon and 462-bp deletion in XAC4131 in pJQ200SK This study
pcXAC4131 XAC4131 with its own promoter cloned in pUFR047, Gmr This study
pJdelfur 1-kb fragment with 291-bp deletion in fur in pJQ200SK This study
Apr, Smr, Gmr, Rifr indicate resistance to ampicillin, streptomycin, gentamycin, rifampicin, respectively
134 J Gen Plant Pathol (2010) 76:132–142
123
Dfur was generated and confirmed by PCR amplification
and sequencing.
Construction of the complemented mutant
The complemented XAC4131 mutant was constructed
by PCR-amplifying an *3.4 kb fragment containing
XAC4131 ORF including its native promoter region. This
fragment was ligated into the broad-host vector pUFR047
to generate pcXAC4131. pcXAC4131 was used to trans-
form E. coli mating cells S17-1(kpir). pcXAC4131 was
introduced into DXAC4131 strain by biparental mating
to generate the complemented mutant strain
DXAC4131(pcXAC4131).
Pathogenicity and HR test
An overnight culture of bacteria grown in the indicated
medium was harvested by centrifugation at 5,0009g for
5 min. The bacterial cells were resuspended in double-
distilled water (DDW) at the indicated cell density. About
100 ll of the bacterial suspension was then used to infil-
trate young fully expanded citrus leaves (Citrus natsudai-
dai Hayata) for the pathogenicity test or into *4-week-old,
nonhost tobacco leaves (Nicotiana tabacum cv. Xanthi) for
HR tests.
The in planta bacterial cell number was determined as
previously described (Shiotani et al. 2000) with slight
modifications. Inoculated leaves were cut with a cork borer
(diameter 10 mm), and the leaf discs were ground with a
sterile mortar and pestle in 1 ml sterile distilled water. The
suspension was diluted serially and spread on a plate of YP
agar containing appropriate antibiotics. Bacterial colonies
were counted after 2 days of incubation at 27�C.
RT-PCR assay
Using an RNeasy Mini Kit (Qiagen, MD, USA), we
extracted RNA from the bacterial culture grown in indi-
cated medium and harvested at the exponential growth
phase (OD660 = 0.4). The purity and concentration of
RNA were determined with a NanoDrop ND-1000 spec-
trophotometer (NanoDrop Technologies, Wilmington, DE,
USA). One microgram of RNA was reverse-transcribed for
60 min at 37�C using random 9-mer oligonucleotides
according to Omniscript kit manual (Qiagen).
Quantitative PCR amplification was performed with
Max Pro Mx3000P (Stratagene, La Jolla, CA, USA) using
a SYBR Premix Ex Taq RT-PCR kit (TaKaRa, Shiga,
Japan). Primers were designed based on the genome
sequence of Xac strain 306, and the sequences are shown in
Table 2. Primer specificity was assessed using the disso-
ciation curve protocol for the MX3000P Multiplex
quantitative PCR system. The efficiency of all primer pairs
was verified. PCR amplification conditions were as fol-
lows: denaturing at 95�C for 30 s, annealing at 55�C for
30 s, and extension at 72�C for 30 s for 40 cycles. Each
PCR experiment was performed in triplicate, and standard
deviations were calculated.
Relative values of transcriptional level were calculated
using DDCT method as previously described (Livak and
Schmittgen 2001; Venkatesh et al. 2006). The fluores-
cence intensity of SYBR green at each point of the
annealing phase was measured, and the cycle threshold
(CT) of each sample was calculated. The calculated CT
data were used for quantitative analysis by the compara-
tive CT method. For each amplification run, the calculated
threshold cycle (CT) for each gene amplificationwas
normalized to the CT of the 16S-rRNA gene amplified
from the corresponding sample before calculating the
difference (fold) between the wild type and mutant using
the following formula:
Fold change ¼ 2�DDCT ;
where DDCT for gene j = (CT,j - CT,16S rRNA)mutant -
CT,j - CT,16S rRNA)wild type.
Results
Neighbor genes of XAC4131
According to the genome sequence of Xac strain 306 (da
Silva et al. 2002), XAC4131 can be found in the region pre-
ceded by two ORFs, rpoEXAC4129 and XAC4130 that encode
the ECF sigma factor family protein and FecR-like protein,
respectively (Fig. 1a). XAC4131 of Xac strain 306 (acces-
sion AAM38966) was annotated as a hypothetical protein,
Table 2 Primers used for RT-PCR
Gene Forward primer (50–30) Reverse primer (50–30)
16S rRNA ggttaagtcccgcaacgag caatccggactgagatagggt
hrpG ccgcttgcgcgcaatgtctc tcctgcgcgcctgcgcgata
hrpXct cgaaacgtcgcccagcctgt aggcatgcgcggcatcttcc
hrpB1 gatcacggtcggactcaccc ctgaggattcgaccggcact
hrcC ctgttgcgcagcatgtacgg cttgctgagctccggccaga
hrpE atggaattattaccgcaaatcag ttactggccaacgagctg
hrpF gacaagatcaacgacccttcca gctcattctgggtgagcgtt
hrcQ gatgtcttgctgcattgcac acttcgggctcaaacgtatc
hrcU caatcccgcaaccggggtca cgcggatgaacagccagtgc
rpoEXAC4129 gcgcatcgaggacatggaac tcggcgatctgtttgtagctca
XAC4130 aggcgcgtttcatggattgg catgtgcggtcgcataggtc
XAC4131 actgccattcccgcacaacc tggtgggcgtgagatagcga
rpoD cattccaggttggtctggtt tacgccaagttcaagaaggt
J Gen Plant Pathol (2010) 76:132–142 135
123
which consists of 984 amino acids (da Silva et al. 2002).
According to Pfam software (http://pfam.sanger.ac.uk/
search) (Finn et al. 2008), XAC4131 was predicted to be a
TonB-dependent receptor that consists of a TonB-dependent
receptor plug domain spanning amino acids 169–281 in the
N-terminal region and the TonB-dependent receptor family
spanning amino acid 717–983 in the C-terminal. The amino
acid sequence in the C-terminal region of XAC4131
(GRTWSLGLRARF) was predicted to form a membrane-
anchoring b-sheet and fits the consensus pattern defined by
Struyve et al. (1991) and Koebnik (1993) for outer membrane
proteins (OMPs). A TonB box (ELDSIQV) is also found in
XAC4131 starting at amino acid 149 and fits the consensus
sequence of tLDXVXV (Blanvillain et al. 2007). With Sig-
nal-P software (http://www.cbs.dtu.dk/services/SignalP/)
(Bendtsen et al. 2004), signal peptidase cleavage site is
predicted to be located after alanine-42, which would lead to
a mature protein of 941 amino acids.
In a homology search using BLAST-P software, the
XAC4131 amino acid sequence of Xac strain 306 (acces-
sion AAM38966) shares high homology with the TonB-
dependent receptor of X. campestris pv. vesicatoria (Xcv)
strain 85-10 (identity = 93%, similarity = 95%) (Thieme
et al. 2005) and Xcc strain ATCC 33913, strain 8004 or
strain B-100 (identity = 68%, similarity = 78%) (da Silva
et al. 2002; Qian et al. 2005; Vorho¨lter et al. 2008).
However, no homolog was found in the genome sequences
of three strains of X. oryzae pv. oryzae (Xoo) (Lee et al.
2005; Ochiai et al. 2005; Salzberg et al. 2008).
Koebnik (2005) predicted that XAC4131 is a TonB-
dependent transducer because it has an N-terminal exten-
sion predicted to function in signal transduction by
interacting with the corresponding FecR-like protein
(XAC4130). For further confirmation, the N-terminal
extension sequence of the XAC4131 mature protein was
compared with the N- terminal extension of mature
proteins of three well-characterized TonB-dependent
transducers: FecA of E. coli (accession AAA23760), PupB
of Pseudomonas putida strain WCS358 (accession
CAA51995) and PrhA of R. solanacearum strain GMI1000
(accession CAD18029). The putative conserved region
Gx10(L,A)L(D,Q,A)G(S,T)L proposed by Marenda et al.
(1998) was found in the N-terminal extension region of the
XAC4131 mature protein with only the first amino acid,
glycine (G), replaced by aspartic acid (D) (Fig. 1b). This
data further suggests that XAC4131 may be involved in the
signal transduction system. However, when XAC4131 was
compared to the amino acid sequence of FecA, PupB, and
PrhA using CLUSTAL_W software (Thompson et al.
1994), the similarity was 17, 15, and 15%, respectively.
The low similarity suggests that the function of XAC4131
differs from that of the three well-characterized TonB-
dependent transducers proteins described.
Construction of DXAC4131 mutant
An in-frame deletion mutant of XAC4131 was constructed
by deleting 462 bp (154 amino acid) in the internal part of
XAC4131 open reading frame (ORF), and a premature stop
codon (TGA) was introduced after the first 576 nt of the
ORF to abrogate the function of the rest of the gene (Fig. 1a;
‘‘Materials and methods’’). The mutant, DXAC4131, was
confirmed by the reduced MW of the PCR product com-
pared with that of the wild type (Fig. 1c) and by sequencing.
When grown in either rich medium (YP) or hrp-inducing
medium (XVM2), growth of the mutant was indistinguish-
able from that of the wild type (data not shown).
Pathogenicity test
Pathogenicity of the DXAC4131 mutant was tested by
inoculating citrus leaves using three methods: infiltration,
pinpricking (Shiotani et al. 2000, 2007) or wounding
(Rigano et al. 2007). After all three methods, the mutant was
able to produce symptoms with severity similar to the case
with the wild type (Fig. 2a; data not shown). In addition,
lesion formation did not differ between the wild type and the
Fig. 1 Isolation of a mutant deleted in XAC4131. a Genetic map of
the region of Xanthomonas axonopodis pv. citri (Xac) strain 306 that
consists of three ORFs: XAC4131, XAC4130 and rpoEXAC4129. Bars
below the map represent fragments used to construct a XAC4131-
deletion mutant. Dashed line between bars indicates the deletion. b
Amino acid sequence alignment of the N-terminal extension of the
mature FecA, XAC4131, PupB, and PrhA proteins. Box indicates
consensus sequence proposed by Marenda et al. (1998). c Confirma-
tion of DXAC4131 by PCR amplification showing the shifted band is
smaller than the wild type
136 J Gen Plant Pathol (2010) 76:132–142
123
mutant even at diluted cell densities to 105 CFU/ml (data
not shown). Moreover, nor did the in planta growth of the
two strains differ after inoculation by infiltration (Fig. 2b).
HR test
HR elicitation was tested on tobacco (Nicotiana tabacum
cultivar Xanthi). Due to difficulties with the wild type NA-
1 strain in eliciting HR in tobacco leaves, the pG* (a point
mutation of Xac hrpG, with its native promoter), which
enhances hrp gene expression (Yamazaki et al. 2008), was
introduced into wild type strain NA-1 and the DXAC4131
mutant.
After infiltration of tobacco leaves with 107 CFU/ml of
either the wild type NA-1(pG*) or mutant DXAC4131(pG*),
DXAC4131(pG*) caused a delay in HR over that with the
wild type NA-1(pG*) (Fig. 3a). At 48 h after infiltration,
tobacco with wild type NA-1(pG*) developed a clear HR,
whereas HR had only started in tobacco infiltrated with
DXAC4131(pG*). However, no difference in HR induction
by the two was found at 48 h after infiltration with a cell
density of 108 CFU/ml (Fig. 3a).
When subsequent bacterial populations for the wild type
and mutant bacteria were determined in the leaves after
infiltrations with an initial cell density of 107 CFU/ml,
survival of the wild type NA-1(pG*) and DXAC4131(pG*)
did not differ in the infiltrated area, up to 36 h after infil-
tration. At 48 h after infiltration, however, the population of
wild type NA-1(pG*) was highly reduced compared with
that of mutant DXAC4131(pG*) (Fig. 3b). The reduction in
the wild type population was probably because HR deve-
loped more rapidly and restricted the wildtype population.
XAC4131 regulates the expression of hrp genes
Because the mutation in XAC4131 affects HR elicitation in
nonhost tobacco, the role of XAC4131 in the expression of
hrp regulatory genes and hrp genes was investigated. As
Fig. 2 Pathogenicity and in planta population of the DXAC4131. a
Symptoms on citrus leaf 12 days after infiltration. b Population in
citrus leaves expressed as colony forming units (CFU) in two leaf
disks (1 cm2) per inoculated leaf and repeated in triplicate. Error bars
indicates standard deviation (±SD) of three independent experiments Fig. 3 Hypersensitive reaction (HR) test and in planta population in
tobacco leaves. a Hypersensitive reaction in leaf of Nicotiana
tabacum cv. Xanthi 48 h after infiltration of with *107 CFU
bacteria/ml (1) and *108 CFU/ml (2). b In planta population in
tobacco leaves over time. Number of CFUs was determined from two
leaf disks (1 cm2) per infiltrated leaf and three replications. Error
bars indicates standard deviation (±SD) of two independent
experiments
J Gen Plant Pathol (2010) 76:132–142 137
123
shown in Fig. 4, the expression of hrpG in the DXAC4131
mutant was about 40% that in the wild type when bacteria
were incubated in hrp-inducing medium. The expression of
hrpXct in the mutant was also significantly lower (about
50%) than that in the wild type, whereas the level of
expression of rpoD, a housekeeping gene used as a control
(Savli et al. 2003), was about the same as that of the wild
type. These results suggest that XAC4131 positively con-
trols the expression of hrpG and hrpXct.
The mutation in XAC4131 significantly reduced all hrp-
regulon genes with the value about 40–60% to the same
extent (Fig. 5a). For further confirmation, both wild type
and DXAC4131 strains containing pG* were grown in
XVM2 medium, and the expression of the hrp genes was
measured. The expression of hrp genes in the mutant strain
was about 10- to 4-fold lower than that in the wild type
(Fig. 5b), and this level of reduction exceeded the levels
obtained in previous experiments using strains without
pG*. These results suggest that XAC4131 affects hrp-gene
expression by controlling the expression of the hrp regu-
latory gene hrpG.
Complementation test
Plasmid pcXAC4131, which contains the XAC4131 gene
with its native promoter cloned in the broad-host vector
pUFR047, was introduced into the mutant strain to gene-
rate the complemented strain DXAC4131(pcXAC4131).
When DXAC4131(pcXAC4131) was grown in XVM2
medium, the expression of hrpG and hrpXct was three to
four times higher than that by the wild type strain con-
taining the empty vector pUFR047 (Fig. 4a). This result
suggests that pcXAC4131 can complement the mutated
XAC4131 gene in the mutant strain. In addition, the
expression of the hrp operons as well as hrpG and hrpXct
in the complemented strain was about 2- to 4-fold higher
than in the wild type (Figs. 4, 5a). These results may be
due to the effect of the copy number of the plasmids.
XAC4131 is regulated by iron status
The expression of the TonB-dependent receptors is widely
known to be regulated by the negative regulator, Fur,
which is dependent on iron status (Braun 1997; Hantke
1981). Thus, we investigated the expression of XAC4131
gene in an iron starvation experiment. The expression of
XAC4131 gene in the iron-limited medium (containing
100 lM 2,20-dipyridil as an iron chelator) was significantly
higher than that in an iron-rich medium (Fig. 6a). We also
examined the expression of the preceding, genes i.e.,
rpoEXAC4129 and XAC4130, which were expressed at higher
levels in the iron-poor medium than in the iron-rich med-
ium (Fig. 6a). The expression of rpoEXAC4129, in particular,
was much higher than in the other two genes.
When Dfur was grown in XVM2 medium with a high
concentration (100 lM) of FeSO4, the expression of
XAC4131, rpoEXAC4129, and XAC4130 was more than 10
times that in the wild type (Fig. 6b). These results suggest
Fig. 4 The expression of hrpG, hrpXct, and rpoD. RNA isolated
from the cultures of NA-1(pUFR047), DXAC4131(pUFR047), and
DXAC4131(pcXAC4131) strains grown in XVM2 medium and
harvested at the exponential growth phase (OD660 = 0.4) was used
for RT-PCR analysis. Values relative to the mean expression in the
wild type (NA-1) were calculated using the DDCT method (Livak and
Schmittgen 2001; Venkatesh et al. 2006). Error bars indicate standard
deviation (±SD) of three independent experiments Fig. 5 Expression of hrp genes of wild type and DXAC4131 strains.
a Relative transcriptional level of hrp genes of NA-1(pUFR047),
DXAC4131(pUFR047), and DXAC4131(pcXAC4131) grown in
XVM2 medium and harvested at the exponential growth phase
(OD660 = 0.4) were examined using qRT-PCR; b The expression of
hrp genes in NA-1(pG*) and DXAC4131(pG*) grown in XVM2
medium and harvested at the exponential growth phase
(OD660 = 0.4). The expression values relative to the mean expression
in the wild type (NA-1) were calculated using the DDCT method.
Error bars indicate standard deviation (±SD) of two independent
experiments
138 J Gen Plant Pathol (2010) 76:132–142
123
that the expression of XAC4131 and the two preceding
genes (rpoEXAC4129 and XAC4130) are dependent on iron
status, which is regulated by Fur.
From the Xac strain 306-sequence data base (da Silva
et al. 2002), the promoter region of each of the three genes
was scrutinized to find the Fur box, that is reported to be
the binding site of Fur protein (Escolar et al. 1998). Using
Genetix-Win software version 5.0.2 (Software Develop-
ment, Tokyo, Japan), we could not find any close homolog
to an E. coli Fur box located in the putative promoter
region of XAC4131, XAC4130, and rpoEXAC4129. However,
dyad symmetry (see later in the underlined sequence) was
found between the –10 and –35 region of the putative
promoter (the boldfaced sequence) of rpoEXAC4129
(GTCACCGCGACGTCATACGACGCCGCTAGCCT).
The dyad symmetry region has been proposed to be
involved in Fur binding in several bacteria (de Lorenzo
et al. 1988; Escolar et al. 1998). In X. campestris pv.
phaseoli (Xcp), dyad symmetry, but without homology to
Fur box of E. coli was found in the promoter region of fur.
The Xcp Fur may recognize variations in the conserved
Fur box of E. coli as for other Gram-negative bacteria
(Loprasert et al. 1999).
XAC4131 regulates the expressions of the adjacent
genes
The expression of genes adjacent to XAC4131 was also
measured in the DXAC4131 mutant background. Expres-
sion of rpoEXAC4129 and XAC4130 in the DXAC4131
mutant was about 18 and 40% of that in the wild type,
respectively (Fig. 7). Thus, we speculated that the control
of the hrp regulatory gene by XAC4131 may involve the
FecR-like protein (XAC4130) and the ECF sigma factor
protein RpoE(XAC4129).
Discussion
Here we have demonstrated that XAC4131, a TonB-
dependent transducer in Xac, regulates the expression of
the hrp regulatory genes as well as the hrp genes. The
delay in HR in nonhost tobacco leaves may be explained in
terms of the lower expression of hrp genes (Fig. 3).
However, it should be noted that several different methods
of inoculation of citrus leaves with various cell densities of
either the DXAC4131 mutant or the wild type did not sig-
nificantly affect disease development (Fig. 2; data not
shown). In addition, the expression of hrpG as well as other
hrp genes was not completely abolished in the DXAC4131
Fig. 6 Relative transcriptional level of genes in NA-1 and Dfur.
a The expression of rpoEXAC4129, XAC4130, and XAC4131 of NA-1
grown in XVM2 medium containing 100 lM FeSO4 and XVM2
medium containing 100 lM 2,20-dipyridyl (DPD) (iron-limited
medium) and harvested at the exponentialgrowth phase
(OD660 = 0.4) were compared. Values relative to the mean expres-
sion in the NA-1 grown in XVM2 medium containing 100 lM FeSO4
were calculated using the DDCT method. Error bars indicate standard
deviation (±SD) of three independent experiments. b Expression of
rpoEXAC4129, XAC4130, and XAC4131 of NA-1 and Dfur mutant
grown in XVM2 medium containing 100 lM of FeSO4 and harvested
at the exponential growth phase (OD660 = 0.4). Values relative to the
mean expression in the wild type (NA-1) were calculated using DDCT
method. Error bars indicate standard deviation (±SD) of three
independent experiments
Fig. 7 Expression of rpoEXAC4129 and XAC4130 in NA-1(pUFR047),
DXAC4131(pUFR047) and DXAC4131(pcXAC4131) strains grown in
XVM2 medium and harvested at the exponential growth phase
(OD660 = 0.4). The transcriptional level was determined using RT-
PCR and the expression values relative to the mean expression in the
WT (NA-1) were calculated using the DDCT method. Error bars
indicate standard deviation (±SD) of three independent experiments
J Gen Plant Pathol (2010) 76:132–142 139
123
mutant grown in the hrp-inducing medium (Figs. 4, 5a).
Thus, we speculate that other unidentified regulator(s)
might control hrpG expression in the hrp-inducing medium
and in planta.
The expression level of hrp genes in the DXAC4131
mutant that are regulated by other regulatory factors seemed
to be enough to cause canker symptom in citrus leaves. Tsuge
et al. (2006) reported that Trh, a transcriptional regulator,
regulates hrpG expression, but there was no significant dif-
ference in the pathogenicity between the trh mutant and the
wild type of Xoo. Furthermore, PrhA, a TonB-dependent
transducer in Ralstonia solanacearum, was shown to be
involved in the regulation of hrpG, but the mutant still
retained pathogenicity, probably via multiple pathways for
the control of hrpG expression (Marenda et al. 1998).
Recently, our laboratory reported that LrpX, a leucine-
rich protein in Xoo, negatively regulates hrpG as well as
the genes in the hrp operons. It has been suggested that
LrpX probably controls the hrp genes expression indirectly
through unknown negative regulator (Islam et al. 2009).
Huang et al. (2009) have demonstrated that in Xcc, Zur (a
transcriptional regulator) controls the expression of the
genes in the hrp operon via HrpX but not via HrpG.
Constitutively expressed hrpX but not hrpG, can bypass the
Zur requirement for the expression of hrpA to hrpF. In our
study, XAC4131 regulates hrp gene expression probably
by controlling hrpG expression, because our data showed
that the reduction in hrpG expression is nearly the same as
that with another regulatory gene hrpXct as well as with
those of the hrp operons. Moreover, in the presence of pG*,
which contains hrpG* (superactive form of hrpG) together
with its native promoter, hrp gene expression in the mutant
background was reduced more than with normal hrpG
(Fig. 5a, b). Thus, the expression of hrpG is thought to be
under the control of XAC4131.
In the wild type, the expression of XAC4131 as well as
those of the preceding genes, rpoEXAC4129 and XAC4130,
were upregulated in the iron-poor condition (Fig. 6a). In
the Dfur mutant grown in the iron-rich condition (100 lM
FeSO4), these three genes were highly upregulated com-
pared to those in the wild type (Fig. 6b). These results
suggest that transcription of these three genes seems to be
regulated by the Fur protein. Fur is a negative regulator that
becomes active in the presence of enough intracellular
Fe2? (Bagg and Neilands 1987). When the concentration of
intracellular Fe2? is increased, Fur protein will bind to the
Fur box in the promoter region of the target genes, which in
turn, will block the binding of RNA polymerase in the
transcription process (Bagg and Neilands 1987).
In our study, the putative promoter regions of XAC4131,
rpoEXAC4129 or XAC4130 did not contain any Fur box
conserved in Gram-negative bacteria. However, a dyad
symmetry of inverted and complementary repeat sequence
was found in the putative promoter region of rpoEXAC4129.
The dyad symmetry region has been proposed to be
involved in Fur binding in several bacteria (de Lorenzo
et al. 1988; Escolar et al. 1998). Likewise in Xcp, there is no
homolog of the consensus sequence of the Fur box of Gram-
negative bacteria, but dyad symmetry is found in the pro-
moter region of fur (Loprasert et al. 1999). Considering the
fact that the Xcp Fur protein inefficiently binds to the con-
served Fur box sequence of Gram-negative bacteria, Xcp
Fur may recognize variations of conserved Fur box found in
other Gram-negative bacteria (Loprasert et al. 1999).
However, because neither the conserved Fur box of
Gram-negative bacteria nor dyad symmetry in the putative
promoter region of XAC4131 was found, XAC4131 may be
regulated by Fur indirectly through the RpoE(XAC4129)
protein, which probably binds at the promoter region of
XAC4131. This hypothesis was supported with our data
(not shown) that a mutation in rpoEXAC4129 caused the
reduced expression of XAC4131.
In R. solanacearum, PrhA, a TonB-dependent trans-
ducer, was reported to control the expression of hrp regu-
latory genes hrpG and hrpB via a three-compartment signal
transduction system that involved proteins PrhI, PrhR, and
PrhJ (Brito et al. 1999, 2002; Marenda et al. 1998). In Xac,
because XAC4131 is not a transcriptional regulator,
XAC4131 may control the expression of hrpG indirectly.
Our data indicated that the mutation in XAC4131 affects
the expression of rpoEXAC4129 and XAC4130 (Fig. 7),
suggesting that the control of hrpG expression by
XAC4131 may require the activation of XAC4130 and
RpoE(XAC4129). However, this hypothesis needs to be
clarified with further supporting data.
In R. solanacearum, the signal that activates PrhA
remains unknown. The signal is located in the plant cell
wall because PrhA functions only when the bacteria are
cultured with the plant cells (Marenda et al. 1998). In our
study, XAC4131 controls the expression of hrpG in hrp-
inducing medium (XVM2); thus, the signal may be present
in this medium. An investigation of the signal responsible
for the activation of XAC4131 awaits the future.
Acknowledgments We thank Drs. U. Bonas, J. Leach, A. Yamazaki
and A. Bogdanove for their encouragements and strains. This research
was supported in part by a Grant-in-Aid (No.17108001) and by a
grant for Promotion in Science (No.13073) from the Ministry of
Education, Culture, Sports, Science and Technology of Japan.
References
Al-Saadi A, Gabriel DW (2002) Molecular characterization of a new
Xanthomonas citri strain isolated in Florida. Phytopathology 92:S3
Ausubel FM, Brent R, Kingston RE, Moore DD, Seidman JG, Smith
JA, Struhl K (1996) Current protocols in molecular biology.
Wiley, New York
140 J Gen Plant Pathol (2010) 76:132–142
123
Bagg A, Neilands JB (1987) Ferric uptake regulation protein acts as a
repressor, employing iron (II) as a cofactor to bind the operator
of an iron transport operon in Escherichia coli. Biochemistry
26:5471–5477
Bendtsen JD, Nielsen H, von Heijne G, Brunak S (2004) Improved
prediction of signal peptides: SignalP 3.0. J Mol Biol 340:783–795
Blanvillain S, Meyer D, Boulanger A, Lautier M, Guynet C, Denance´
N, Vasse J, Lauber E, Arlat M (2007) Plant carbohydrate
scavenging through TonB-dependent receptors: a feature shared
by phytopathogenic and aquatic bacteria. PLoS ONE 2:e224.
doi:10.1371/journal.pone.0000224
Braun V (1995) Energy-coupled transport and signal transduction
through the gram-negative outer membrane via TonB-ExbB-
ExbD-dependent receptor proteins. FEMS MicrobiolRev
16:295–307
Braun V (1997) Surface signaling: novel transcription initiation
mechanism starting from the cell surface. Arch Microbiol
167:325–331
Brito B, Marenda M, Barberis P, Boucher C, Genin S (1999) prhJ and
hrpG, two new components of the plant signal-dependent
regulatory cascade controlled by PrhA in Ralstonia solanacea-
rum. Mol Microbiol 31:237–251
Brito B, Aldon D, Barberis P, Boucher C, Genin S (2002) A signal
transfer system through three compartments transduces the plant
cell contact-dependent signal controlling Ralstonia solanacea-
rum hrp genes. Mol Plant Microbe Interact 15:109–119
Brunings AM, Gabriel DW (2003) Xanthomonas citri: breaking the
surface. Mol Plant Pathol 4:141–157
da Silva AC, Ferro JA, Reinach FC, Farah CS, Furlan LR, Quaggio
RB, Monteiro-Vitorello CB et al (2002) Comparison of the
genomes of two Xanthomonas pathogens with differing host
specificities. Nature 417:459–463
de Feyter R, Yang Y, Gabriel DW (1993) Gene-for-genes interactions
between cotton R genes and Xanthomonas campestris pv.
malvacearum avr genes. Mol Plant Microbe Interact 6:225–237
de Lorenzo V, Herrero M, Giovannini F, Neilands JB (1988) Fur
(ferric uptake regulation) protein and CAP (catabolite-activator
protein) modulate transcription of fur gene in Escherichia coli.
Eur J Biochem 173:537–546
Duan YP, Castan˜eda A, Zhao G, Erdos G, Gabriel DW (1999)
Expression of a single, host-specific, bacterial pathogenicity
gene in plant cells elicits division, enlargement, and cell death.
Mol Plant Microbe Interact 12:556–560
Eddy SR (1996) Hidden Markov models. Curr Opin Struct Biol
6:361–365
Escolar L, Pe´rez-Martı´n J, de Lorenzo V (1998) Binding of the Fur
(ferric uptake regulator) repressor of Escherichia coli to arrays
of the GATAAT sequence. J Mol Biol 283:537–547
Finn RD, Tate J, Mistry J, Coggill PC, Sammut SJ, Hotz HR, Ceric G,
Forslund K, Eddy SR, Sonnhammer ELL, Bateman A (2008)
The Pfam protein families database: R.D. Database Issue.
Nucleic Acids Res 36:D281–D288
Graham JH, Gottwald TR, Cubero J, Achor DS (2004) Xanthomonas
axonopodis pv. citri: factors affecting successful eradication of
citrus canker. Mol Plant Pathol 5:1–15
Hantke K (1981) Regulation of ferric iron transport in Escherichia
coli K-12: isolation of a constitutive mutant. Mol Gen Genet
182:288–292
Horton RM, Cai ZL, Ho SN, Pease LR (1990) Gene splicing by
overlap extension: tailor-made genes using the polymerase chain
reaction. Biotechniques 8:528–535
Huang DL, Tang DJ, Liao Q, Li XQ, He YQ, Feng JX, Jiang BL, Lu
GT, Tang JL (2009) The Zur of Xanthomonas campestris is
involved in hypersensitive response and positively regulates the
expression of the hrp cluster via hrpX but not hrpG. Mol Plant
Microbe Interact 22:321–329
Islam MR, Kabir MS, Hirata H, Tsuge S, Tsuyumu S (2009) A
leucine-rich protein, LrpX, is a new regulator of hrp genes in
Xanthomonas oryzae pv. oryzae. J Gen Plant Pathol 75:66–71
Kanamori H, Tsuyumu S (1998) Comparison of nucleotide sequences
of canker-forming and non-canker-forming pthA homologues in
Xanthomonas campestris pv. citri. Ann Phytopathol Soc Jpn
64:462–470
Kaniga K, Delor I, Cornelis GR (1991) A wide-host-range suicide
vector for improving reverse genetics in gram-negative bacteria:
inactivation of the blaA gene of Yersinia enterocolitica. Gene
109:137–141
Koebnik R (1993) Structural organization of TonB-dependent recep-
tors. Trends Microbiol 1:201
Koebnik R (2005) TonB-dependent trans-envelope signalling: the
exception or the rule? Trends Microbiol 13:343–347
Lee BM, Park YJ, Park DS, Kang HW, Kim JG, Song ES, Park IC,
Yoon UH, Hahn JH, Koo BS, Lee GB, Kim H, Park HS, Yoon
KO, Kim JH, Jung CH, Koh NH, Seo JS, Go SJ (2005) The
genome sequence of Xanthomonas oryzae pathovar oryzae
KACC10331, the bacterial blight pathogen of rice. Nucleic
Acids Res 33:577–586
Lefebvre B, Formstecher P, Lefebvre P (1995) Improvement of the
gene splicing overlap (SOE) method. Biotechniques 19:186–188
Livak KJ, Schmittgen TD (2001) Analysis of relative gene expression
data using real-time quantitative PCR and the 2(-DDC(T))
method. Methods 25:402–408
Loprasert S, Sallabhan R, Atichartpongkul S, Mongkolsuk S (1999)
Characterization of a ferric uptake regulator (fur) gene from
Xanthomonas campestris pv. phaseoli with unusual primary
structure, genome organization, and expression patterns. Gene
239:251–258
Marenda M, Brito B, Callard D, Genin S, Barberis P, Boucher C,
Arlat M (1998) PrhA controls a novel regulatory pathway
required for the specific induction of Ralstonia solanacearum
hrp genes in the presence of plant cells. Mol Microbiol 27:437–
453
Matsumoto H, Muroi H, Umehara M, Yoshitake Y, Tsuyumu S
(2003) Peh production, flagellum synthesis, and virulence
reduced in Erwinia carotovora subsp. carotovora by mutation
in a homologue of cytR. Mol Plant Microbe Interact 16:389–397
Moeck GS, Coulton JW (1998) TonB-dependent iron acquisition:
mechanisms of siderophore-mediated active transport. Mol
Microbiol 28:675–681
Nikaido H, Rosenberg EY (1990) Cir and Fiu proteins in the outer
membrane of Escherichia coli catalyze transport of monomeric
catechols: study with beta-lactam antibiotics containing catechol
and analogous groups. J Bacteriol 172:1361–1367
Ochiai H, Inoue Y, Takeya M, Sasaki A, Kaku H (2005) Genome
sequence of Xanthomonas oryzae pv. oryzae suggests contribu-
tion of large numbers of effector genes and insertion sequences
to its race diversity. Jpn Agric Res Q 39:275–287
Qian W, Jia Y, Ren SX, He YQ, Feng JX, Lu LF, Sun Q, Ying G,
Tang DJ, Tang H, Wu W, Hao P, Wang L, Jiang BL, Zeng S, Gu
WY, Lu G, Rong L, Tian Y, Yao Z, Fu G, Chen B, Fang R,
Qiang B, Chen Z, Zhao GP, Tang JL, He C (2005) Comparative
and functional genomic analyses of the pathogenicity of
phytopathogen Xanthomonas campestris pv. campestris. Gen-
ome Res 15:757–767
Quandt J, Hynes MF (1993) Versatile suicide vectors which allow
direct selection for gene replacement in gram-negative bacteria.
Gene 127:15–21
Rigano LA, Siciliano F, Enrique R, Sendı´n L, Filippone P, Torres PS,
Qu¨esta J, Dow JM, Castagnaro AP, Vojnov AA, Marano MR
(2007) Biofilm formation, epiphytic fitness, and canker devel-
opment in Xanthomonas axonopodis pv. citri. Mol Plant Microbe
Interact 20:1222–1230
J Gen Plant Pathol (2010) 76:132–142 141
123
Salzberg SL, Sommer DD, Schatz MC, Phillippy AM, Rabinowicz
PD, Tsuge S, Furutani A et al (2008) Genome sequence and rapid
evolution of the rice pathogen Xanthomonas oryzae pv. oryzae
PXO99A. BMC Genomics 9:204. doi:10.1186/1471-2164-9-204
Sambrook J, Fritsch EF, Maniatis T (1989) Molecular cloning: a
laboratory manual. Cold Spring Harbor Laboratory Press, Cold
Spring Harbor
Savli H, Karadenizli A, Kolayli F, Gundes S, Ozbek U, Vahaboglu H
(2003) Expression stability of six housekeeping genes: a
proposal for resistance gene quantification studies of Pseudo-
monas aeruginosa by real-time quantitative RT-PCR. J Med
Microbiol 52:403–408
Sennett C, Rosenberg LE, Mellman IS (1981) Transmembrane
transport of cobalamin in prokaryotic and eukaryotic cells. Annu
Rev Biochem 50:1053–1086
Shiotani H, Ozaki K, Tsuyumu S (2000) Pathogenic interactions
between Xanthomonas axonopodis pv. citri and cultivars of
pummelo (Citrus grandis). Phytopathology 90:1383–1389
Shiotani H, Fujikawa T, Ishihara H, Tsuyumu S, Ozaki K (2007) A
pthA homolog from Xanthomonas axonopodis pv. citri respon-
sible for host-specific suppression of virulence. J Bacteriol
189:3271–3279
Struyve´ M, Moons M, Tommassen J (1991) Carboxy-terminal
phenylalanine is essential for the correct assembly of a bacterial
outer membrane protein. J Mol Biol 218:141–148
Swarup S, de Feyter R, Brlansky RH, Gabriel DW(1991) A
pathogenicity locus from Xanthomonas citri enables strains from
several pathovars of X. campestris to elicit cankerlike lesions on
citrus. Phytopathology 81:802–809
Swarup S, Yang Y, Kingsley MT, Gabriel DW (1992) An Xantho-
monas citri pathogenicity gene, pthA, pleiotropically encodes
gratuitous avirulence on nonhosts. Mol Plant Microbe Interact
5:204–213
Thieme F, Koebnik R, Bekel T, Berger C, Boch J, Bu¨ttner D, Caldana
C et al (2005) Insights into genome plasticity and pathogenicity
of the plant pathogenic bacterium Xanthomonas campestris pv.
vesicatoria revealed by the complete genome sequence. J Bac-
teriol 187:7254–7266
Thompson JD, Higgins DG, Gibson TJ (1994) CLUSTAL_W: improv-
ing the sensitivity of progressive multiple sequence alignment
through sequence weighting, position-specific gap penalties and
weight matrix choice. Nucleic Acids Res 22:4673–4680
Tsuge S, Nakayama T, Terashima S, Ochiai H, Furutani A, Oku T,
Tsuno K, Kubo Y, Kaku H (2006) Gene involved in transcrip-
tional activation of the hrp regulatory gene hrpG in Xanthomo-
nas oryzae pv. oryzae. J Bacteriol 188:4158–4162
Venkatesh B, Babujee L, Liu H, Hedley P, Fujikawa T, Birch P, Toth
I, Tsuyumu S (2006) The Erwinia chrysanthemi 3937 PhoQ
sensor kinase regulates several virulence determinants. J Bacte-
riol 188:3088–3098
Vorho¨lter FJ, Schneiker S, Goesmann A, Krause L, Bekel T, Kaiser
O, Linke B et al (2008) The genome of Xanthomonas campestris
pv. campestris B100 and its use for the reconstruction of
metabolic pathways involved in xanthan biosynthesis. J Bio-
technol 134:33–45
Wengelnik K, Marie C, Russel M, Bonas U (1996) Expression and
localization of HrpA1, a protein of Xanthomonas campestris pv.
vesicatoria essential for pathogenicity and induction of the
hypersensitive reaction. J Bacteriol 178:1061–1069
Yamazaki A, Hirata H, Tsuyumu S (2008) HrpG regulates type II
secretory proteins in Xanthomonas axonopodis pv. citri. J Gen
Plant Pathol 74:138–150
Zou LF, Wang XP, Xiang Y, Zhang B, Li YR, Xiao YL, Wang JS,
Walmsley AR, Chen GY (2006) Elucidation of the hrp clusters
of Xanthomonas oryzae pv. oryzicola that control the hypersen-
sitive response in nonhost tobacco and pathogenicity in suscep-
tible host rice. Appl Environ Microbiol 72:6212–6224
142 J Gen Plant Pathol (2010) 76:132–142
123
	A TonB-dependent transducer is responsible for regulation of pathogenicity-related genes in Xanthomonas axonopodis pv. citri
	Abstract
	Introduction
	Materials and methods
	Bacterial strains, plasmids and culture conditions
	Recombinant DNA techniques
	Construction of Xac mutants
	Construction of the complemented mutant
	Pathogenicity and HR test
	RT-PCR assay
	Results
	Neighbor genes of XAC4131
	Construction of Delta XAC4131 mutant
	Pathogenicity test
	HR test
	XAC4131 regulates the expression of hrp genes
	Complementation test
	XAC4131 is regulated by iron status
	XAC4131 regulates the expressions of the adjacent genes
	Discussion
	Acknowledgments
	References