Baixe o app para aproveitar ainda mais
Prévia do material em texto
Prof. Dr. Antonio Carlos Pignatari Laboratório Sergio Franco-DASA Hospital 9 de Julho Material biológico • Sangue • Líquor • Urina • Secreção respiratória • Secreção de pele, subcutâneo e mucosas • Fezes • Líquido articular, pleural, pericárdico, ascite, humor aquoso e vítreo • Biópsias Testes rápidos para detecção do agente etiológico � Microscopia � Antígeno � Anticorpo � Acido nucleico: RNA, DNA � Espectometria: Proteínas Testes rápidos � Dengue � HIV � Influenza � Adenovirus � Sincicial respiratório � Estreptococo do grupo A � Antígenos de meningococo, pneumococo, e haemophilus em líquor � Pneumococo em urina e líquido pleural � Estreptococo do grupo B em secreção vaginal � Toxina A e B de Clostridium difficile � Legionela em urina � Monotest – mononucleose infecciosa Microbiologia molecular diagnóstica � Custo benefício para os pacientes � Custo benefício para o hospital � Custo benefício para o laboratório clínico � Custo benefício para o sistema de saúde público e privado Vantagens � Alta sensibilidade e especificidade � Possibilidade de quantificação � Rapidez no processamento laboratorial Pre-requisitos � Necessidade de laboratório especializado em biologia molecular � Equipe tecnica especializada � Com exceção do GeneXpert Plataformas de amplificação e detecção de ácidos nucleicos � PCR convencional – gel de agarose, in house � Real-time PCR – varios marcadores para emissão de sinal, curvas de amplificação com detecção computadorizada, formato simples ou multiplex, in house ou kits comerciais � Microarray – multiplex � Luminex – multiplex � GeneXpert � Sequenciadores – 16 S, 18 S REAÇÃO DE POLIMERIZAÇÃO EM CADEIA - PCR �1983 - Kerry Mullis – Thermus aquaticus �Oligonucleotideos iniciadores – primers �Termocicladores – amplificação das cópias de DNA – 2n T 94° C 72° C 52°C a 65° C Saiki et al., 1988 Konena et al., 2006 Multiplex-PCR Detecção de MβL Mendes et al. J Clin Microbiol. 2007. Diagnóstico Molecular em Amostras Clínicas Kit comerciais In House PLATAFORMA ROCHE PLATAFORMA APPLIED BIOSYSTEM Amplificação do DNA - PCR EM TEMPO REAL Equipamentos METODOLOGIA SYBR GREEN TAQMAN FRET METODOLOGIA SYBR GREEN TAQMAN LightCycler® 7500 REAL TIME PCR SYSTEM www.roche.com www.appliedbiosystems.com.br Multiplex RT-PCR Detecção de MβL � SPM – 798 bp; 83,5° C � SIM – 569 bp; 80,4° C � VIM – 382 bp; 88,5° C � IMP – 188 bp; 77° C � GIM – 72 bp; 72° C Mendes et al. J Clin Microbiol. 2007. LUMINEX MULTIPLEX Virus Respiratórios Infecções intestinais - virus, bactérias, protozoários e toxinas (E. coli, Clostridium difficile, Toxina shiga-like) Liquor - bactérias, vírus , fungos Sangue – bactérias e fungos Sequenciamento do gene blaKPC Seqüência Editada Pesquisada no Banco do NIH utilizando o programa BLAST Principais testes disponíveis para infecções virais � Carga viral para HIV � Carga viral para virus das hepatites B e C � PCR qualitativo e quantitativo para CMV � PCR para Influenza H1N1 � Painel Viral Respiratório � PCR para Enterovirus � PCR para Herpes virus : Herpes simples, Varicela zoster EB virus e CMV � PCR para Parvovirus � PCR para adenovirus Principais testes disponíveis para infecções bacterianas � PCR para Clostridium difficile � PCR para Mycobacterium tuberculosis � PCR para detecção de genes de resistência a antimicrobianos : mecA, vanA, KPC, New Dehli, � PCR para Clamídea (trachomatis e pneumoniae) � PCR par Mycoplasma pneumoniae � PCR para meningococo, pneumococo e haemophilus (liquor) GENES DE RESISTÊNCIA A ANTIMICROBIANOS � Bactérias Gram positivas: • mecA – resistência a Betalactâmicos - Staphylococcus • vanA; vanB – Resistência a Vancomicina - Enterococcus � Bactérias Gram negativas: • ESβL: blaCTX-M; blaTEM; blaSHV: Resistência aos Betalactâmicos com excessão de Cefoxitina, Cefotetan e Carbapenêmicos • Carbapenemases: blaKPC : Resistência a Carbapenêmicos • Metalo-β-Lactamases: blaIMP; blaVIM; blaSPM : Resistência a Carbapenêmicos e Betalactâmicos (exceto monobactâmicos) Silveira et al., 2006 Bush, 2010 Hackbarth et al., 1989 Background Acute respiratory tract infection in children represents a high number on the World Health Organizations statistics data, the high incidence of respiratory tract infection is highly observed in developing countries including Brazil. Viruses are recognized as the major cause of these infections and usually suspected in clinical practice. Emerging virus and new stains is well detected by Molecular Biology methods, the sensibility and specificity allows Molecular Biology to detect more than one virus of the panel from the same sample allowing specific treatment. Laboratory diagnosis of viral respiratory tract infections in a Children’s Hospital in São Paulo, Brazil, one year study. Pignatari, A. C. C.; Cruz, S. E. M; Faro, L. B.; Gaburo, N.; Bousso, A.; Sapieza, A.; Lora, F. M.; Almeida, L. R. References 1. Diniz, E.M.A; Vieira R.A; Ceccon M.E.J; Ishida M.A; Flávio Adolfo Costa Vaz F.A.C. Incidence of respiratory viroses in preterm infants submitted to mechanical ventilation. Methods All results of respiratory virus panel of all pacients of a children´s hospital in the city of São Paulo Brazil from January to December 2013 were collected using the laboratory system Motion ®. The respiratory virus panel is done by RT-PCR Microarray: CLART® Pneumovir. The molecular biology panel detects Influenza A, Influenza A H1N1 strain 2009, Influenza B, Parainfluenza1, 2, 3 and 4, Syncycial Respiratory Virus (SRV) A and B, Adenovirus, Bocavirus, Metapneumovirus, Coronavirus, Enterovirus and Rhinovirus. Results 1325 samples were tested on the respiratory virus panel, 1437 tests were positive Tab1,2,3 considering samples with more than one positive virus. The months with higher positivity were from march to june these months represent the colder seasons the begin of autumn and the begin of winter in Brazil. April showed the major positivity, 28% when compared with the other months Tab2. The most frequent viruses identified were, SRV 36%, Bocavirus 14%, Methapneumovirus 7,2% and Adenovirus 6,3%. The samples analyzed were collected from Children from 0 to 14 years old and the positivity in young children under 2 years old is observed in 80% of the positive samples and on April that showed the highest positivity, 94%, the samples were from children under 2 yeas old. Conclusion The molecular panel detected a wide range of respiratory virus, including 2 stains of Influenza A H3N2, this shows that molecular biology keeps the best methodology to identify respiratory tract viruses. The results is given in two or three days, for over 90% of the samples the rapid test to detect SRV were realized which is helpful for the primary clinical practice but the rapid test does not have precise identification and it detects only one virus, the most important pathogen, other important virus are only detected by the molecular panel. Temporary Number: 958 Permanent Number: B-048 Title: Laboratory diagnosis of viral respiratory tract infections in a Children’s Hospital in São Paulo, Brazil, one year study Session: 10/Infectious Disease JAN FEB MAR APR MAY JUN JUL AGU SEP OCT NOV DEC Total % Adenovirus 5 2 14 19 18 10 4 2 3 4 5 3 89 6,30% Bocavírus 4 6 17 54 47 35 8 10 8 6 3 3 201 14,00% Enterovírus (echovírus) 4 6 17 24 8 8 3 0 0 3 3 2 78 5,50% Influenza A 0 0 0 0 1 1 0 0 0 0 0 1 3 0,30% Influenza A H1N1/2009 0 0 3 15 12 3 2 0 0 0 0 0 35 2,50%Influenza B 0 0 1 4 5 6 0 1 2 1 0 0 20 1,40% Influenza C 0 0 2 3 o 2 0 0 1 0 0 0 8 0,60% Methapneumovírus A 4 2 5 7 6 4 3 4 3 2 0 0 40 3,00% Methapneumovírus B 3 2 11 5 6 10 6 4 2 8 2 0 59 4,20% Parainfluenza 1 0 0 1 2 5 1 1 0 0 0 0 0 10 0,70% Parainfluenza 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0% Parainfluenza 3 2 3 2 7 7 3 3 2 4 2 1 4 40 3,00% Parainfluenza 4 1 5 7 5 6 2 0 4 0 0 0 4 34 2,50% Rhinovírus 10 18 43 67 37 39 18 26 7 8 5 9 287 20% RSV A 4 19 75 165 84 33 28 10 1 6 1 4 430 29% RSV B 1 1 23 37 27 5 3 1 2 3 0 0 103 7% Total 38 64 221 414 269 162 79 64 33 43 20 30 1437 100,00% JAN FEB MAR APR MAY JUN JUL AGU SEP OCT NOV DEC Total of panel 60 69 175 288 252 181 132 56 38 46 22 75 Positive 34 (56%) 54 (78%) 149 (85%) 251 (87%) 174 (69%)102 (56%) 58 (43%) 31 (55%) 26 (68%) 27 (58%) 12 (54%) 20 (26%) Number of Virus/ positive JAN FEB MAR APR MAY JUN JUL AGU SEP OCT NOV DEC 1 virus/ positive panel 31 45 92 131 107 56 37 22 19 14 5 13 2 virus/ positive panel 2 9 42 86 46 36 21 8 7 11 6 4 3 virus/ positive panel 1 0 14 26 14 7 0 1 0 2 1 3 4 virus/ positive panel 0 0 1 8 6 2 0 0 0 0 0 0 5 virus/ positive panel 0 0 0 0 1 1 0 0 0 0 0 0 Tab1. Number of processed panel and positive results Tab2. Identified virus by RT-PCR Microarray – CLART Pneumovir Tab3. Positive panel according with the number identified by test GeneXpert®: The Molecular Lab in a Cartridge �3 areas of assays � Infectious Disease �Oncology �Genetic Disease �All Testing Done Within Cartridge � Sample Prep � Amplification �Detection �Same Basic Cartridge Works With all Tests and GeneXpert® Systems GeneXpert cartridge: High complexity lab in a small package (FDA Moderate complexity) A Better Way to Platform Design GX-1 GX-4 GX-16 GeneXpert Infinity-48 GeneXpert® Module http://www.cepheid.com Diagnóstico Molecular em Amostras Clínicas Xpert SA Nasal Complete Xpert vanA Xpert C. difficile Xpert MRSA/SA SSTI Xpert MRSA/SA BC Xpert MRSA Xpert EV Xpert GBS Xpert HemosIL Smart GBS Kit comerciais - Cepheid’s Xpert 27 Sample =vaginal swab Solution: Rapid, reliable intrapartum test for GBS colonization 2. Reagent 1 into port 1 3. Reagent 2 into port 2 1. Break off swab in port labeled S for sample Results starting at 35 min ! GGCACCAGCCAGCTGAGCCAATTCATGGACCAGAACAACCCGCTG TCGGGGTTGACCCACAAGCGCCGACTGTCGGCGCTG 507 rpoB gene 533 * ** * * *** **** * * 81 base pair core region ** *** ** **** *** ** ** Insertion TTC Insertion TTCATG Deletion CCATTC Deletion GGCACC Del AAC Deletion CAGAAC Deletion GACCAG Deletion AATTCATGG Deletion GAACAA Genetics of Rifampin Resistance in M. tuberculosis Majority of mutations associated with rifampin resistance Occur in 81 base pair (27 amino acid) region of rpoB (RNA polymerase gene) Cepheid Gene Xpert® C difficile Assay Place swab with stool into buffer vial, vortex, pipette into cartridge. Close top and place into instrument. • Rapid detection of toxin B gene in 47 minutes • 99% Sensitive, 91% Specific vs Direct Toxigenic culture • Detects the 027 epidemic strain PAGE | 30 Inter-relatedness of Healthcare Associated Pathogens Which is often treated with clindamycin Which selects for Which selects for Which can donate the vanA resistance gene Which may lead to Clostridium difficile VRE MRSA Which is treated with oral vancomycin VRSA (or VISA) Surveillance Methods Microbiology Culture • Least cost • Medium labor • Slowest TAT BD Gene-Ohm Conventional Real time PCR • Medium cost • Most labor • Run in batches • Medium TAT GeneXpert® Real time PCR • Highest cost • Least labor • Random access • Rapid TAT Previous gold standard (2+ day TAT) Detection of Cytotoxin B direct from stool in cell culture Normal, negative or toxin + antitoxin = neutralized (no effect) Positive - CPE Stool supernatant <1% of U.S. labs doing this test and it takes at least 2 days Cell culture cytotoxin neutralization (CCCN) Emergence of an epidemic strain BI/NAP-1/027 • Associated with hospital outbreaks of severe disease • Associated with severe morbidity (toxic mega-colon, sepsis- like syndrome) • High case-fatality rate • Fluoroquinolone resistant • Produces >20x more toxin B (due to a deletion in TcdC toxin production regulatory gene) & a binary toxin • Produces larger #s of spores, leading to larger inocula and easier transmission REA PFGE PCR Ribotype Toxinotype III Enzyme immunoassays for toxins A&B 97% of U.S. labs doing this test !! Takes < 2 hrs Glutamate Dehydrogenase (GDH) Clostridium difficile “common antigen” thought to be present in all strains Cepheid Gene Xpert® C difficile Assay Place swab with stool into buffer vial, vortex, pipette into cartridge. Close top and place into instrument. • Rapid detection of toxin B gene in 47 minutes • 99% Sensitive, 91% Specific vs Direct Toxigenic culture • Detects the 027 epidemic strain Phoenix ® BD MicroScan Walkaway ® Dade Behring Identificação Bacteriana Vitek 2® BioMérieux Api ® BioMérieux RT-PCR 16s MALDI-TOF na Microbiologia Bactéria (Amostra) Proteínas Carboidratos Lipídios DNA RNA … MALDI-TOF Espectro de Massa Característica da espécie Impressão Digital “fingerprint” MALDI Matrix Assisted Laser Desorption/Ionization Ionização Dessorção Laser Processo de ionização por dessorção a laser assistida por matriz Formação de íons Espécies químicas eletricamente carregadas Liberação de uma substância de uma superfície ou através dela Matriz Amplificação da luz estimulada por radiação Molécula orgânica envolvida no processo de ionização e dessorção Energia (comp. de onda) para o processo de dessorção MALDI-TOF Time of Flight Tubo sob vácuo Tempo de Vôo + MALDI-TOF Time of Flight Tubo sob vácuo + Tempo de Vôo 1 µL de matriz (ácido alfa-ciano-4 hidroxicinamico) 10 mg/mL) 900 µL etanol absoluto 300 µL H2O 50µL ácido fórmico 70% + 50µL acetonitrila 1 µL sobrenadante 2 min/13.000 rpm 2 min/13.000 rpm MALDI Biotyper 2.0 Microflex LT MALDI-TOF Tempo de Análise: 1 minuto por amostra Tempo de extração da amostra: 5 minutos Alça Transferência direta da colônia Ponteira Swab Tempo de preparo: segundos + 1 µL de matriz Carbonnelle et al. Clin Biochem. 44:104-109, 2011. Espectros de Massa Diferentes Microorganismos Diferentes Espectros de Massa Identificação da espécie Seleção da colônia Inoculação na placa de MALDI-TOF Microrganismo desconhecido ? Interpretação dos dados Geração de um Espectro protéico MALDI-TOF em Etapas Limitações � Banco de Dados � Fungos filamentosos �Microorganismos com parede espessa � Testes de sensibilidade � Número de células (mínimo 104) Vantagens � Custo � Fácil implementação � Fácil manuseio � Tempo � Confiável � Paciente �R$ 0,40 por amostra �Somente instalação elétrica �Não gera resíduos �Simples preparação da amostra �Software – simples operação �Não precisa de especialista em massas �Apresenta ¼ do custo de outras metodologias � Preparo de placa e resultados (entre 1 - 2 horas / 96 amostras) � Acima de 98% de acurácia � Diminui o custo � Diagnóstico e terapia em menor tempo Identificação (MALDI-TOF MS) + Teste de Sensibilidade Painéis para uso comunitário � Infecções respiratórias � Infecções intestinais � Infecções de SNC Painéis para usohospitalar � Infecções respiratórias � Infecções intestinais � Infecções de SNC � Infecções de corrente sanguínea � Culturas de vigilância Pneumonia bacteriana Acinetobacter baumannii Bordetella pertussis Chlamydophila pneumonia Haemophilus influenza Haemophilus influenza (Type B) Klebsiella pneumonia Legionella pneumophila MRSA - Meth. resistant S. aureus PVL gene Moraxella catarrhalis Mycoplasmapneumonia Neisseria meningitides Pseudomonas aeruginosa Staphylococcus aureus Streptococcus pneumonia Streptococcus pyogenes Group A Virus respiratórios Coxsackie viruses/echovirus Adenovirus types 3, 4, 7, 21 Human Bocavirus Human Coronavirus Human metapneumovirus Influenza A - Human influenza Influenza A - H1N1-09 Influenza B Parainfluenza virus type 1,2,3,4 Respiratory syncytial virus A Respiratory syncytial virus B Rhinoviruses Pneumonia atípica: Bordetella pertussis Chlamydophila pneumonia Legionella pneumophila Mycoplasma pneumoniae � Infecções em ambiente hospitalar � Acinetobacter baumannii � Enterobacter aerogenes � Enterobacter cloacae � Enterococcus faecalis � Enterococcus faecium � Escherichia coli � Klebsiella pneumonia � Proteus mirabilis � Pseudomonas aeruginosa � Serratia marcescens � Stenotrophomonas maltophilia � Streptococcus pyogenes Group A � MRSA - Meth. resistant S. aureus � Staphylococcus aureus PVL gene � Methicillin resistant coag. neg. Staph � Coagulase negative Staphylococcus � Staphylococcus epidermidis � Cultura de Vigilância �MRSA �ESBL �VRE Is repeat test needed for the diagnosis of Clostridium difficile infection if PCR is the method? Robert F. Luo, Niaz Banaei (Stanford UMC) J. Clin. Microbiol. 2010. 48:3738- Result following the first test with a negative result 293 patients (24% of all pts) 406 repeat tests (ave. 1.5/pt) PCR Sens 87.2%; Spec 98.6% 7 new TP’s at ≥7 days <1% repeat tests gave + result <7 days
Compartilhar