Biotecnologia
53 pág.

Biotecnologia


DisciplinaGenética Molecular291 materiais3.663 seguidores
Pré-visualização2 páginas
Bibliotecas, sequenciamento e transformação 
genética
Instituto de Biologia
Departamento de Genética
Disciplina: Genética molecular
Profa. Marilene
marilene.ufrrj@gmail.com
\u2022 Fagos - partículas virais que invadem e destroem bactérias
\u2022 Na década de 40 
\u2022 "tesouras" moleculares, que a bactéria emprega para se defender dos 
bacteriófagos
\u2022 Enzimas produzidas por bactérias para restringir a proliferação de vírus 
invasores
Enzimas de restrição
\u2022 O fenômeno, conhecido como restrição controlada pelo hospedeiro, 
foi descrito pela primeira vez no início da década de 50. 
\u2022 Werner Arber, um microbiologista suíço, encontrou uma explicação 
molecular para o fenômeno. 
\u2022 Ele sugeriu que as bactérias controlam os fagos com um sistema de 
reações geneticamente controladas que ele designou restrição -
modificação.
\u2022 Proteínas que reconhecem e clivam o DNA em pontos específicos, 
geralmente em sequências de 4, 6 e 8 bases - palíndromas
RY 13
Exemplo: EcoR I
Escherichia coli 1º enzima a ser 
descoberta nesta 
bactéria
Gênero
Estirpe Espécie
Ordem de 
descoberta
Corte com Eco RI Corte com Eco RI
Fragmentos com 
Extremidades coesivas
vazio
vazio
Anelamento permite que moléculas de
DNA recombinante realizem um 
pareamento complementar.
As duas fitas não estão ligadas
covalentemente como pode ser visto 
nas 
áreas circuladas (vazio)
\u2022 Quando os bacteriófagos entram numa bactéria da linhagem A, são em 
sua maioria mortos no interior da bactéria, que corta (cliva) o DNA em um 
ou mais pontos. Os poucos fagos que se replicam no interior da bactéria, 
contudo, parecem "aprender" a evitar o ataque da bactéria e, numa 
segunda infecção, já produzem um grande número de partículas virais 
novas. Quando estes fagos procuram infectar uma bactéria da mesma 
espécie, porém de uma outra linhagem (digamos, B), inicialmente produz 
uma progênie pequena e apenas na segunda infecção na mesma linhagem 
bacteriana é que se adapta e produz um grande número de partículas virais 
novas. Se transportado a um tubo de ensaio com a bactéria A original, o 
fenômeno se repete, como se o fago tivesse "desaprendido" a infectar a 
bactéria do tipo A. 
Bibliotecas
\u2022 São coleções de sequências de DNA
\u2022 Genes recombinantes
\u2022 Utilização diversa
\u2022 Isolamento de um gene
\u2022 Sequenciamento
\u2022 Clonagem....
Biblioteca
Genômica
cDNA
Biblioteca genômica
\u2022 Coleção de fragmentos de DNA de uma determinada espécie
\u2022 Fragmentos obtidos por meio da ação de enzimas de restrição, 
clonados e ligados a vetores
\u2022 Representa o genoma do organismo
Bibliotecas
Vetores
Vetores de clonagem molecular
\u2022 Pequenas moléculas de DNA
\u2022 são moléculas de DNA capazes de amplificar, 
em centenas de cópias, a informação 
genética que nelas foi inserida.
Biblioteca genômica
Plasmídeos
\u2022 DNA circular, bifilamentar extracromossômico; 
presente em microorganismos, principalmente 
bactérias; 
\u2022 De 1 a 200 kb de tamanho. 
\u2022 Acomodam fragmentos de até 30 mil pares de bases
Vetores
Vetores de clonagem molecular
Biblioteca genômica
YACs (Yeast Artificials Cromossomes) \u2013 acomodam de 300 mil a 1 milhão de pb
BAC (bacterial artificial chromosome ) - até 300 mil pb
Sítio de replicação
Resistência a 
ampicilina 1. Uma origem de 
replicação; 
2.Um gene marcador 
selecionável (em geral 
confere resistência a 
drogas); 
3.Sítio de clivagem única. 
Beta-lacmatase \u2013
resistência a ampicilina
Lac Z \u2013 beta galoctosidade
Beta-lacmatase \u2013
resistência a ampicilina
Lac Z \u2013 beta galoctosidade
\u2022 A enzima cliva também o composto 
Xgal em galactose e 5-bromo-4-
cloroindigo 
2. Fragmentos gerados enzimas de restrição
3. Fragmentos são ligados ao DNA 
4. Transfecção
Biblioteca genômica
1. Extração do DNA genômico total
2. Clivar o DNA do vetor 
5. Seleção das bactérias transformadas
\u2022 Como identificar os clones transformados?
\u2022 Células de E. coli, sensíveis a ampicilina, são transformadas com 
plasmídeos que conferem resistência ao antibiótico. Apenas as células 
transformadas serão capazes de crescer na presença de ampicilina.
\u2022 Os plasmídeos de clonagem têm uma segunda marca de resistência a 
antibióticos (em geral, tetraciclina), que é perdida quando o 
plasmídeo é aberto e o inserto é clonado. 
DNA recombinante
\u2022 Complementary DNA
\u2022 Construída pela cópia de um mRNA presente em um determinado 
tecido e possui apenas a informação funcional
Biblioteca cDNA
1. Extração do RNA total
2. Transcriptase reversa
3. Dupla hélice híbrida 3. RNase
4. Síntese cDNA
5. Transfecção, seleção de vetores transformados
\u2022 Método de Sanger, 1975
\u2022 Terminação por dideoxinucleotídeo
\u2022 Síntese de cópias parciais de DNA
\u2022 Terminação prematura ao acaso e em bases específicas
\u2022 Produção de fragmentos de diferentes tamanhos, terminado em cada 
uma das diferentes bases
Sequenciamento
Sequenciamento
\u2022 Dideoxinucleotídeo trifosfasto, ou ddNTP.
\u2022 dNTP, ou desoxiribonucleotídeo trifosfato - apresenta uma hidroxila 
na posição 3´.
\u2022 ddNTP - não tem esta hidroxila. 
\u2022 Se for incorporado a uma fita de DNA, interrompe a incorporação de 
outros nucleotídeos a partir dele. 
\u2022 Marcar o ddNTP - radiação ou fluorescência,
\u2022 Logo, fita interrompida ficará radiativa ou fluorescente e poderá ser 
detectada mais facilmente. 
\u2022 Vamos admitir que cada didesoxibase está marcada com uma 
florescência diferente. 
\u2022 As fitas terminadas em A, T, G ou C vão emitir cores diferentes
quando excitadas com luz de um determinado comprimento (em
geral, de um feixe laser).
Sequenciamento
Como a reação de sequenciamento pode começar sempre
exatamente da mesma base?
\u2022 A partir do DNA molde que adicionamos à reação. 
\u2022 Uma nova fita simples só é sintetizada se tivermos:
\u2022 DNA molde,
\u2022 DNA polimerase, 
\u2022 dNTPs (e neste caso, um pouco de ddNTPs fluorescentes) 
\u2022 um primer
O primer sempre pareia exatamente na posição esperada, jamais uma base antes
ou uma depois.
Dessa forma, todas as fitas estendidas a partir deste primer iniciam rigorosamente
na mesma base, a partir do primer e copiando a fita molde.
Sequenciamento
\u2022 As fitas produzidas podem ser separadas pelo tamanho em 
eletroforese de poliacrilamida, e a base final da sequência da fita 
identificada pela fluorescência emitida quando a banda eletroforética
correspondente à fita cruza o ponto do gel que é iluminado por um 
feixe de laser.
\u2022 Neste sistema de detecção a eletroforese não pára, as bandas 
passando no fim (em baixo) do gel é que são detectadas em 
movimento. Com isto, podemos identificar com precisão 600 a 700 
bases a partir do primer.
Sequenciamento
NNNNNNNNNNNNNNNNNNNNNNTCTCTTATATANNATTCCCGCCTTCNNTAAAGT
ATGCAAATAATGTCTGGTTTTAAAGTAATGATTAACTGCATGCTCAGGATAATAGG
GTTTGATGCCTTTATCCATGGGAAAATATTTGGTAACCTTAGGATAAAATCTAGCT
GGCATAACCAATTTTAATCTTCGTAATTCATTTTTAGTAAGTGGGCCTACAAATTGT
TCACATTTAGAAATCAGGTCTTGATGCAAATGAATATTAGGAAAAGAAGNANTGNA
CCAGTTAGGATTAAAAGCAGGCACAGTAGAAGAGTAAAGCCCCGTAAAGTTTCC
CACCTTATGAGTCCAAGGAATACTAACATTGGNAAGCTGGAGATTGAGATCTGCG
GCGACGCGGTGATTGAGATCTTCGTCTGCGAGGNGAGNNAGTTCTTCTNCTAG
GGGACCTGCCTCGTCGNCTAACAACAGTAGTTTCCGGAAGTGTGNATAGGATAG
GGGCNTTTGGTGGTCTGTANGCAGGANGAGTGCGAATCNNCACTCNNAAGGAC
ACCAAATACTCTAGNACTGTNCTCTTCCAAAAGTAAGGCAGGAAATGTGANNNNA
CANCAGNNGTCTANNTTNNNNNNNNNNNNNNNNAACNTAGNNAACTACTAAANC
CCTANCTNNNNCNNNNCANNNNNNNNNNCNCCCNAGNNNGCNANNNNCATNN
CCTNNNNCNNNANANNNNNNANNNTNNCTNNNNNCCNTNNNGNNNNNAANNNN
NNANNNNCAGNNNANNNNNNNNNNNNNNNNNAANNNNNNNNNNNNNNNTNNN
NNANNNNNNNNNNNNGGNNNANNCANNNNNN
Formato de saída \u2013 SEQ
Transformação genética
1. Clonagem e isolamento do gene
\u2022 Identificar o gene responsável
\u2022 Desenvolver bibliotecas genômicas