3_Marcadores
26 pág.

3_Marcadores


Disciplina<strong>biotecnologia</strong>13 materiais5 seguidores
Pré-visualização1 página
Aula 3:
Marcadores moleculares
Biotecnologia vegetal
Ferramentas:
\u2013 Biologia molecular:
\u2022 Marcadores moleculares
\u2022 DNA recombinante
\u2013 Fisiologia vegetal:
\u2022 cultura de tecidos
\u2013 Engenharia genética
\u2022 transgenia
Biotecnologia vegetal
Biotecnologia x melhoramento
\u2013 Multiplicação do material 
melhorado classicamente
\u2013 Caracterização de parentais e 
progênie no melhoramento 
clássico
\u2013 Melhoramento biotecnológico
Marcadores moleculares
\u2022 Todo e qualquer fenótipo oriundo de um 
segmento específico de DNA
\u2022 Sequência de DNA e função 
frequentemente desconhecidos
\u2022 Detecção de polimorfismo
\u2022 Aplicações na pesquisa básica e no 
melhoramento
Marcadores moleculares
Bom marcador deve ser:
\u2022 polimórfico
\u2022 fácil de obter e analisar
\u2022 barato
\u2022 rápido
\u2022 reprodutível
\u2022 seletivamente neutro
\u2022 grande cobertura do genoma
Polimorfismos moleculares
DNA
gel
ATGGAT ATGCAT
Indivíduo 1 Indivíduo 2
Marcadores moleculares
Principais marcadores moleculares
\u2022 Baseados em hibridização em membrana:
\u2013 RFLPs (Restriction Fragment Length Polymorphism) \u2013
polimorfismos no comprimento de fragmentos de restrição;
\u2013 VNTRs (Variable Number of Tandem Repeats) ou minisatélites;
\u2022 Baseados em PCR:
\u2013 RAPDs (Random Amplified Polymorphic DNA) \u2013 polimorfismo de 
DNA amplificado ao acaso ou AP-PCR (Arbitrarily Primed-
Polymerase Chain Reaction);
\u2013 AFLP (Amplified Fragment Length Polymorphism) \u2013 polimorfismo de 
comprimento de fragmentos amplificados;
\u2013 SSR (Simple Sequence Repeats) ou microsatélites;
\u2013 ISSR (Inter Simple Sequence Repeats) \u2013 polimosfismo entre loci 
SSR
\u2013 CAPS (Cleaved Amplified Polymorphic Sequence) \u2013 polimorfismo 
de seqüência amplificada e clivada;
...
Hibridização em membrana \u2013
Southern blot
PCR \u2013 reação em cadeia da 
polimerase
Ferreira & Grattapaglia (1995) Introdução ao uso de marcadores moleculares em análise genética
PCR \u2013 reação em cadeia da 
polimerase
Principais marcadores moleculares
primer enzima de restrição
Marcadores moleculares
Marcadores moleculares
Como escolher o marcador?
\u2022 Disponibilidade da técnica
\u2022 Disponibilidade de métodos de analise
\u2022 Infra-estrutura do laboratório
\u2022 Custo da técnica
\u2022 Aplicação/pergunta
Tipo de marcador
Aluana Abreu
Fingerprinting de DNA
Fingerprinting de DNA
Figure 1. RAPD profiles of grape DNA generated with the 21-mer GY169 (CTAAGCTGCTTTTGTTTGAGC) (panel A) 
and pear DNA with the 18-mer GY107 (GTTCAGGGCTGTTTATAG) (panel B). The amplification products were 
separated by electrophoresis in 2% agarose gels, visualized by staining with ethidium bromide, and photographed on a 
transilluminator using Polaroid. 
http://www.nysaes.cornell.edu/hort/faculty/reisch/longprime.htm
A B
RAPD
Rose Samuel, Univesidade de Viena, Áustria
Fingerprinting de DNA
AFLP
Microssatélites
Ferreira & Grattapaglia (1995) Introdução ao uso de marcadores moleculares em análise genética
primer foward
primer reverse
Microssatélites
Ferreira & Grattapaglia (1995) Introdução ao uso de marcadores moleculares em análise genética
\u2022 Vantagens:
\u2013 mais alto nível de polimorfismo 
entre marcadores 
(multialelismo);
\u2013 amplamente distribuídos no 
genoma.
\u2022 Limitações:
\u2013 exige a construção prévia de 
bibliotecas próprias;
\u2013 alto custo, por envolver 
sequenciamento e a síntese de 
um grande número de primers
Microssatélites
Coloração com 
nitrato de prata
Detecção fluorescente
Biotecnologia vegetal
Biotecnologia x melhoramento
\u2013 Multiplicação do material 
melhorado classicamente
\u2013 Caracterização de parentais e 
progênie no melhoramento 
clássico
\u2013 Melhoramento biotecnológico
Fingerprinting de DNA Mapeamento genético
Mapeamento genético
Mapa genético do feijão comum \u2013 Mapa da Flórida
Vallejos et al. 1992. Genetics
Representação do genoma de uma espécie em que a posição relativa 
entre marcadores é baseada em frequências de recombinação
Mapeamento genético
peso 
do
fruto
acidez sólidos
solúveis
Bibliografia
Aula 2
Brammer, S.P., Milach S.C.K. (2002) Marcadores 
genéticos usados em plantas. In: Brammer, S.P. 
et al. Atualização em técnicas celulares e 
moelculares aplicadas ao melhoramento genético 
vegetal. Passo Fundo: EMBRAPA,. 404 p.
Material suplementar