15
Física para Cientistas e Engenheiros - Volume 1

Exercícios resolvidos: Física para Cientistas e Engenheiros - Volume 1

Gene Mosca, Paul Allen TiplerIBSN: 9788521617105

Elaborado por professores e especialistas

Passo 1 de 10keyboard_arrow_downkeyboard_arrow_up

Sabemos que a conformação da proteína é definida pelo arranjo espacial sem que haja quebra de suas ligações covalentes, e seu enovelamento ocorre sobre as ligações simples. As proteínas nativas são conhecidas, pois se tratam de quaisquer estruturas dobradas delas que sempre se encontram no estado de estabilidade.

Passo 2 de 10keyboard_arrow_downkeyboard_arrow_up

(a)

As estruturas das proteínas nativas se mantêm no estado de estabilidade através de interações hidrofóbicas e pela força de Van der Waals.

A estabilidade é fornecida por cada ligação de hidrogênio, sendo que, para cada ligação que se forma durante o enovelamento, outra é quebrada no mesmo grupo, o que caracteriza, então, a forca de Van der Waals, sob interações fracas.

Passo 3 de 10keyboard_arrow_downkeyboard_arrow_up

(b)

Conforme a figura abaixo, podemos observar que os grupos R 1,2,4,5,8 e 9 se estendem do lado direito e os grupos R 3,6,7 e 10 se estendem pelo lado esquerdo.

Passo 4 de 10keyboard_arrow_downkeyboard_arrow_up

(c)

Uma das respostas corretas poderá ser a sequência:

N- Phe – Ile – Glu – Val – Met – Asn – Ser – Ala – Phe – Glen – C

relacionando com os grupos R:

N – 1 – 2 – 3 – 4 -5 – 6 – 7 – 8 – 9 – 10 – C

Passo 5 de 10keyboard_arrow_downkeyboard_arrow_up

(d)

A sequência de DNA possível para a alternativa (c) será:

Fita molde

(5’) – TTTATTGAAGTAATGAATAGTGCATTCCAG – (3’)

..................................................................

(3’) – AAATAACTTCATTACTTATCACGTAAGGTC – (5’)

Fita não molde

Passo 6 de 10keyboard_arrow_downkeyboard_arrow_up

(e)

Dentre os aminoácidos que podem ser codificados pelo triplete NTN são: Phe, Leu, Ile, Met e Val que são todos hidrofóbicos, porém não apresenta todos os aminoácidos hidrofóbicos do grupo, faltando o Trp, Pro, Ala e Gly.

Passo 7 de 10keyboard_arrow_downkeyboard_arrow_up

(f)

Dentre os aminoácidos que podem ser codificados pelo triplete NAN são: Tyr, His, Gln, Asn, Lys, Asp e Glu, sendo todos hidrofílicos, porém o Tyr do grupo é o que possui menos caráter hidrofílico. Não é apresentado todos os hidrofílicos do grupo, fazendo parte ainda o Ser, Thr e Arg.

Passo 8 de 10keyboard_arrow_downkeyboard_arrow_up

(g)

Foi preciso tirar T da mistura da reação, pois Tyr não é muito hidrofílico para criar os códons de NAN, excluindo todos que iniciam e terminam com ele como o TAG e TAA.

Passo 9 de 10keyboard_arrow_downkeyboard_arrow_up

(h)

Não é formada uma banda porque uma protéina mal dobrada gera quebra na ligação, ou seja, degradação na células e análise por SDS somente determina proteínas sem quebras de ligações ou degradações. Sendo assim, se não é identificada, então, poderá ser que ela esteja dobrada incorretamente.

Passo 10 de 10keyboard_arrow_downkeyboard_arrow_up

(i)

Nem todas as proteínas possuem as mesmas características: muitas delas poderiam ser rompidas quando as ligações de hidrogênios fossem formadas entre as cadeias laterais. Outros motivos vão além da força de Van der Waals, como nem todas as sequências tendem à forma α-hélice.

Navegar por capítulo

O passo a passo dos exercícios mais difíceis

12xR$ 14,90 /mêsCancele quando quiser, sem multa

E mais

  • check Videoaulas objetivas
  • check Resumos por tópicos
  • check Salve para ver depois
  • check Disciplinas ilimitadas
  • check Filtros exclusivos de busca