150
Princípios de Bioquímica de Lehninger - 6ª Ed. 2014

Exercícios resolvidos: Princípios de Bioquímica de Lehninger - 6ª Ed. 2014

David L Nelson, Michael M MIBSN: 9788582710722

Elaborado por professores e especialistas

ALUNOS QUE TAMBÉM VISUALIZARAM

  • +27.433

Exercício

Tradução do RNA mensageiro Quais seriam as sequências de aminoácidos dos peptídeos formados pelos ribossomos em resposta às seguintes sequências de mRNA, considerando que a fase de leitura inicia com as três primeiras bases em cada sequência?

(a) GGUCAGUCGCUCCUGAUU

(b) UUGGAUGCGCCAUAAUUUGCU

(c) CAUGAUGCCUGUUGCUAC

(d) AUGGACGAA

Passo 1 de 8keyboard_arrow_downkeyboard_arrow_up

Para resolver este problema, você deve considerar que ambos, DNA e RNA, contêm duas bases púricas principais que são a adenina (A) e guanina(G) respectivamente, além de duas bases pirimidinas. Uma delas é a citosina(C) que é comum ao DNA e RNA. Já as outras duas bases piridiminas, são a timina (T) para o DNA e a Uracila (U) para o RNA.

Passo 2 de 8keyboard_arrow_downkeyboard_arrow_up

Com exceção do RNA do genoma de certo vírus, todas as moléculas de RNA derivam de informações armazenadas no DNA. Esse processo é chamado de transcrição, onde um sistema enzimático converte a informação genética da fita dupla de DNA formando uma fita dupla de RNA que tem uma sequência de bases que é complementar ao DNA. São produzidas três moléculas principais de RNA, sendo que os RNAs mensageiros (RNAm) são responsáveis por codificar a sequência de aminoácidos especificados pelos genes.

Passo 3 de 8keyboard_arrow_downkeyboard_arrow_up

A sequência específica de aminoácidos de uma proteína é construída a partir da informação contida no RNAm, sendo especificados pelos códons, que são tripletes de nucleotídeos que codificam um aminoácido específico. Desta forma, os códons são a chave para a tradução do código genético que levará à síntese de proteínas específicas.

Passo 4 de 8keyboard_arrow_downkeyboard_arrow_up

A tabela contendo a sequência de dados de códons, deduzida a partir de experimentos com as respectivas proteínas é apresentada na página 1107 do livro (Figura 27.7). A partir dela é possível definir a sequência de aminoácidos formada a partir dos códons abaixo.

Passo 5 de 8keyboard_arrow_downkeyboard_arrow_up

a)

A sequência de aminoácidos formada a partir de GGUCAGUCGCUCCUGAUU será:

Gly-Gln-Ser-Leu-Leu-Ile

Passo 6 de 8keyboard_arrow_downkeyboard_arrow_up

b)

A sequência de aminoácidos formada a partir de UUGGAUGCGCCAUAAUUU GCU será: Leu-Asp-Ala-Pro

Passo 7 de 8keyboard_arrow_downkeyboard_arrow_up

c)

A sequência de aminoácidos formada a partir de CAUGAUGCCUGUUGCUAC será

Hist-Asp-Ala-Cys-Cys-Tyr.

Passo 8 de 8keyboard_arrow_downkeyboard_arrow_up

d)

A sequência de aminoácidos formada a partir de AUGGACGAA será: Met- Asp-Glu para organismos eucariotos. No caso das bactérias, que são organismos procariotos, a sequência será fMet- Asp-Glu.

Depoimentos de estudantes que já assinaram o Exercícios Resolvidos

Nathalia Nascimento fez um comentárioCEFET/RJ • Engenharia
Foi um apoio àquelas aulas que não acabam totalmente com as dúvidas ou mesmo naquele momento de aprender o conteúdo sozinha. Além disso, dispensou a necessidade de um orientador e por isso, permitiu que eu estudasse em qualquer local e hora.
Valdivam Cardozo fez um comentárioUFRB • Engenharia
Tive uma sensação maior de autonomia nos estudos, as vezes era frustante não conseguir resolver uma determinada questão e nem sempre os professores corrigem as listas que passam.