A maior rede de estudos do Brasil

Nesse sentido, considere que o fragmento abaixo faz parte do RNAm que codifica uma proteína vital ao desenvolvimento da praga: AAUC

O setor agrícola conta com uma nova ferramenta biotecnológica para combater pragas agrícolas. Criadas em laboratório, as moléculas de RNAi neutralizam a ação de um gene-alvo em um organismo qualquer – daí a expressão silenciamento gênico.

Com efeito inseticida, ela foi criada para controlar a larva-alfinete americana (Diabrotica virgifera), fase larval de um besouro que é a principal ameaça às plantações de milho naquele país.

 

Disponível em: <https://revistapesquisa.fapesp.br/2018/06/18/genes-em-silencio/>. Acesso em: 22 mai 2019. (adaptado)

 

Analisando o texto acima, percebemos que o uso do RNAi como bioinseticida é uma ferramenta promissora no combate as pragas agrícolas. A molécula de RNAi atua nas lavouras impedindo que o RNAm da praga em questão sintetize uma determinada proteína importante ao seu desenvolvimento.

Nesse sentido, considere que o fragmento abaixo faz parte do RNAm que codifica uma proteína vital ao desenvolvimento da praga:

 

AAUCGCGGUAACGGGCAUAGC

5’                                                     3’

 

Para combater o desenvolvimento da praga, a molécula de RNAi deverá apresentar quais bases nitrogenadas?


3 resposta(s) - Contém resposta de Especialista

User badge image

RD Resoluções Verified user icon

Há mais de um mês

Precisamos entender a princípio sobre as bases nitrogenadas. Sabemos que tanto o DNA e o RNA são ácidos nucleicos que estão presentes nos seres vivos. No DNA sabemos que a adenina se liga a timina e a guanina se liga a citosina. Logo, agora pode traçar a fita complementar dessa fita.

Temos a seguinte fita;


\[AAUCGCGGUAACGGGCAUAGC\]

Agora basta trocar A por T e G por C, desta forma teremos a seguinte fita complementar;


\[{TTAGCGCCATTGCCCGUAUCG}\]

Portanto temos acima a fita complementar do DNA citado no enunciado que combaterá o desenvolvimento de pragas. Essa fita também é conhecida como RNA.

Precisamos entender a princípio sobre as bases nitrogenadas. Sabemos que tanto o DNA e o RNA são ácidos nucleicos que estão presentes nos seres vivos. No DNA sabemos que a adenina se liga a timina e a guanina se liga a citosina. Logo, agora pode traçar a fita complementar dessa fita.

Temos a seguinte fita;


\[AAUCGCGGUAACGGGCAUAGC\]

Agora basta trocar A por T e G por C, desta forma teremos a seguinte fita complementar;


\[{TTAGCGCCATTGCCCGUAUCG}\]

Portanto temos acima a fita complementar do DNA citado no enunciado que combaterá o desenvolvimento de pragas. Essa fita também é conhecida como RNA.

Essa pergunta já foi respondida por um dos nossos especialistas