ARTIGO

Esta é uma pré-visualização de arquivo. Entre para ver o arquivo original

Contents lists available at ScienceDirect
Aquaculture
journal homepage: www.elsevier.com/locate/aquaculture
Evaluation of enzyme- and Rhizopus oligosporus-treated high oil residue
camelina meal on rainbow trout growth performance and distal intestine
histology and inflammatory biomarker gene expression
Stephanie A. Collinsa, Saipeng Xiea, Jennifer R. Hallb, Margot B. Whitec, Matthew L. Rised,
Derek M. Andersona,⁎
a Department of Plant and Animal Science, Dalhousie University, Faculty of Agriculture, Truro, NS B2N 5E3, Canada
b Aquatic Research Cluster, CREAIT Network, Memorial University of Newfoundland, 1 Marine Lab Road, St. John's, NL A1C 5S7, Canada
c Perennia Food and Agriculture, 173 Innovation Drive, Bible Hill, NS B6L 2H5, Canada
d Department of Ocean Sciences, Memorial University of Newfoundland, 1 Marine Lab Road, St. John's, NL A1C 5S7, Canada
A R T I C L E I N F O
Keywords:
Rainbow trout
Camelina
High oil residue camelina meal
Enzyme
Rhizopus oligosporus
Growth
Histology
Gene expression
A B S T R A C T
The effect of high oil residue camelina meal (HORM) and treated HORM on rainbow trout growth performance
and related parameters was determined. Two isocaloric, isonitrogenous diets containing fish meal at a level of
100 g/kg and fish oil at a level of 50 g/kg were formulated. One was a control diet, and the other contained
HORM at an 80 g/kg inclusion level. In an additional five test diets, HORM was replaced with treated HORM
(water-soaked HORM, pectinase HORM, Superzyme HORM, High-Pectinase Superzyme HORM (HP-SZ HORM)
or Rhizopus HORM/wheat (1:3 wheat:HORM fermented with R. oligosporus; R-HORM). Test ingredients in treated
HORM diets were mixed with water and/or their respective enzymes, then incubated for 24 h at 40 °C or fer-
mented by R. oligosporus fungus for 72 h. Diets were fed to rainbow trout (average weight: 33.7 g; 30 fish/126 L
tank; 3 tanks/treatment) in a freshwater (11.8 ± 0.7 °C), flow-through system for 112 days. Treatment of
HORM with water or enzyme provided intermediate growth between the control and R-HORM diets and the
initial four weeks on test. On day 28, fish fed the control diet had a higher specific growth rate (SGR) than fish
fed HORM and R-HORM and a higher thermal growth coefficient than fish fed R-HORM (P < 0.05). On day 56,
control-fed fish had a significantly higher weight gain and fork length than water-soaked HORM- and R-HORM
-fed fish. On day 112, fish fed the control diet had a higher SGR than fish fed R-HORM and fish fed all diets
except water-soaked HORM had a longer fork length (P < 0.05) than fish fed R-HORM (P < 0.05). There were
no significant differences in the transcript levels of eight inflammatory biomarker genes (GILTa, GILTb, PAR2a,
PAR2b, IL1ß3, MyD88, TGFß1a and TGFß1b) in the distal intestines of fish fed the HORM, HP-SZ HORM or R-
HORM diets, compared with fish fed the control diet. An inclusion level of 80 g/kg HORM and water- and
enzyme-treated HORM (all three treatments) are acceptable in juvenile rainbow trout diets. Future studies may
involve similar treatments at higher dietary inclusion levels and HORM fermented with R. oligosporus using a
substrate other than wheat.
1. Introduction
Camelina (Camelina sativa), an oilseed crop commonly called false
flax or gold of pleasure (Zubr, 1997), is being developed as a potential
alternative feed ingredient for fish. High oil residue camelina meal
(HORM) is a by-product generated when oil produced by the camelina
seed is extracted using a mechanical expeller process. It contains ap-
proximately 34% crude protein and 10 to 13% residual oil (NRC, 2011).
Camelina oil contains high levels of unsaturated fatty acids, especially
α-linolenic (18:3 n-3) which accounts for 37.8% of the total fatty acids
(Zubr, 2003).
Despite their nutritional value, a potential limitation of the use of
plant-based aquafeed ingredients such as camelina is that they contain
antinutritional factors (ANFs) that affect the taste and digestibility of
the feed (Matthäus and Zubr, 2000). These ANFs include glucosinolates,
mucilage, phytic acid, sinapine and tannins (Matthäus and Zubr, 2000;
Russo and Reggiani, 2012; Schuster and Friedt, 1998). Glucosinolates,
as well as their degraded products, are some of the primary ANFs of
http://dx.doi.org/10.1016/j.aquaculture.2017.09.017
Received 12 June 2017; Received in revised form 7 September 2017; Accepted 9 September 2017
⁎ Corresponding author.
E-mail address: danderson@dal.ca (D.M. Anderson).
Abbreviations: HORM, High oil residue camelina meal; FCR, Feed conversion ratio
Aquaculture 483 (2018) 27–37
Available online 25 September 2017
0044-8486/ © 2017 Elsevier B.V. All rights reserved.
T
http://www.sciencedirect.com/science/journal/00448486
https://www.elsevier.com/locate/aquaculture
http://dx.doi.org/10.1016/j.aquaculture.2017.09.017
http://dx.doi.org/10.1016/j.aquaculture.2017.09.017
mailto:danderson@dal.ca
https://doi.org/10.1016/j.aquaculture.2017.09.017
http://crossmark.crossref.org/dialog/?doi=10.1016/j.aquaculture.2017.09.017&domain=pdf
concern in camelina meal (Schuster and Friedt, 1998). Mucilage is a
gel-forming fiber, which in camelina, consists of acidic and neutral
polysaccharides (Zubr, 2010). The crude fiber content of camelina seed
ranges from 7.6–13%, with a mucilage content of 6.7% (Zubr, 1997;
Zubr, 2010). Phytic acid is found in many legumes and oilseeds and
reduces the solubility and biological availability of phosphorus and
other mineral elements such as calcium, magnesium, zinc and iron, by
producing complexes that cannot be digested or absorbed by the animal
(Russo and Reggiani, 2012; Francis et al., 2001; Hossain and Jauncy,
1993). Tannins can precipitate proteins, thereby inhibiting the activity
of digestive enzymes. Tannins also hinder the use of vitamins and mi-
nerals in the digestive tract (Russo and Reggiani, 2012). Matthäus and
Zubr (2000) reported a range of 21.9–30.1 mg/g total inositol phos-
phate (phytic acid) in 15 samples of camelina oilseed cake. In these
same 15 samples, sinapine (a bitter component of Brassica oilseeds)
levels ranged from 1.7–4.2 mg/g and condensed tannin levels were
between 1.0 and 2.4 mg/g.
Previous work by Hixson et al. (2014) has shown that the sub-
stitution of fish meal with 10% solvent-extracted camelina meal in-
hibited the growth of Atlantic salmon (Salmo salar). As camelina meal
contains ANFs, this inhibited growth may have been a direct result of
ANFs in the feed. Therefore, investigating methods to reduce the ANFs
present in camelina meal and related products is paramount to increase
the value of this n-3 fatty-acid-containing, plant-based protein source
for use in aquafeeds.
The effects of some ANFs can be tempered based on the level that is
included in the diet; whereas others can be inactivated or eliminated
through ingredient processing. Processing methods such as water-
soaking and dietary enzymes (Egounlety and Aworh, 2003) and fer-
mentation with the Rhizopus oligosporus fungus may help eliminate or
alleviate the negative influence of some ANFs in camelina and other
plant meals. For example, water-soaking can reduce about 90% of the
glucosinolates in Brassica vegetables (Song and Thornalley, 2007).
Research involving the application of carbohydrase enzymes, such as
xylinases, cellulases and pectinases, to plant-based feed ingredients
included in aquafeeds is also increasing in effort to elucidate methods of
improving the nutrient availability and utilization of these ingredients
(Castillo and Gatlin, 2015).
Rhizopus, a fungus with a low pathogenicity (level 1 biosecurity), is
used to make tempeh, a pre-fermented dish from soybeans. Rhizopus
grows at a maximum temperature of 48 °C, enabling inactivation at
higher temperatures (Hartanti et al., 2015). Rhizopus treatment (R.
oligosporus) of lupins effectively reduced alkaloids and increased crude
protein composition during the fermentation process (Ortega-David and
Rodriguez-Stouvenel, 2014). R. oligosporus may also have potential
detoxifying applications in reducing glucosinolate levels in Brassica
meals and, as a fungus that digests cellulose fibers, it may also reduce
the negative impact of mucilage.
The objective of this project was to determine the effect of water,
enzyme and R. oligosporus treatment on the ANF content of HORM, as
well to determine the suitability of these treated HORM products as
feed ingredients for rainbow trout.
2. Materials and methods
2.1. Experimental ingredients
Camelina (Calena cultivar) was grown and harvested in Canning,
Nova Scotia (Canada) under the supervision of Dalhousie University,
Faculty of Agriculture (Truro, NS, Canada) staff. Atlantic Oilseed
Processing, Ltd. (Kinkora, Prince Edward Island, Canada) extracted
the oil from the seeds using a KEK P-0500 expeller-press (EGON
KELLER GMBH and CO. KG, Remscheid, Germany). The remaining
high-oil presscake was hammer-milled (screen size 8 mm) to yield a
high oil residue camelina meal (HORM). Ethoxyquin (60% ethox-
yquin, 40% silica) was added to the HORM at an inclusion rate of 0.2%
of the predicted oil content of the HORM, in order to prevent oxida-
tion.
Six ingredients (Table 1) were tested in this experiment: untreated
HORM, water-soaked HORM, pectinase-treated HORM (pectinase
HORM), multi-carbohydrase (Superzyme™-OM Concentrate)-treated
HORM (Superzyme HORM), High-Pectinase Superzyme™-OM Con-
centrate-treated HORM (HP-SZ HORM), and R. oligosporus-treated
HORM and wheat (R-HORM). The water-soaked and enzyme-treated
HORM products were prepared using the following ingredient ratios:
Water-soaked HORM: 1000 g HORM + 7000 mL water; pectinase
HORM: 1000 g HORM+ 7000 mL water + 0.015 g pectinase, Super-
zyme HORM: 1000 g HORM+ 7000 mL water + 0.06 g Superzyme™-
OM Concentrate; HP-SZ HORM: 1000 g HORM+ 7000 mL water
+ 0.015 g High Pectinase Superzyme™-OM Concentrate. Once all in-
gredients were combined to make a treated HORM product, the mash
was mixed for 10 min, then incubated for 24 h at 40 °C in a forced-air
oven. After incubation, the mash was spread thinly over parchment
paper laid out on large metal sheets and dried in a forced-air oven for
48 h at 45 °C. The Superzyme™-OM Concentrate contained (unit/g):
14,000 cellulase; 13,675 amylase; 9800 xylanase; 5000 protease; 4025
glucanase; 2800 invertase; 2075 mannanase, 1350 pectinase. The Pec-
tinase was in liquid form and contained 2500 units of pectinase ac-
tivity/g. The High-Pectinase Superzyme™-OM Concentrate contained
(units/g): 9225 cellulase; 8975 amylase; 6450 xylanase; 3300 protease;
2750 glucanase; 1850 invertase; 1375 mannanase, 1350 pectinase. All
enzymes were provided by Canadian Biosystems Inc. (Calgary, AB,
Canada) and were administered based on the instructions of the man-
ufacturer.
To make the R-HORM test ingredient via surface-activated bio-
fermentation (SAB), a combination of HORM and whole wheat kernels
was subjected to hot water pasteurization to prepare the HORM/wheat
material for inoculation with R. oligosporus fungus (ATCC 22959). To
pasteurize the HORM/wheat in preparation for inoculation, HORM,
wheat and water were combined at a ratio of 1.33 kg camelina: 0.67 kg
wheat: 2.56 kg water and held at 70 °C for 2 h. The post-pasteurized
HORM/wheat was inoculated with ATCC-approved R. oligosporus at a
rate of 106 conidia per mL. The inoculated product was then spread
onto shallow trays in a grow-out pilot system developed at the Atlantic
BioVenture Centre (previously Nova Scotia Agricultural College, cur-
rently Dalhousie University, Faculty of Agriculture, Truro, NS, Canada)
and incubated for five days within a controlled access sterilized warm
room environment with filtered air and heat provided and CO2 re-
moval. Upon completion of the SAB process, the HORM/wheat material
was dried in a forced-air oven at 45 °C for 72 h in order to deactivate
the R. oligosporus fungus and to attain a product with a moisture
level< 8%. The stabilized product was ground using a hammer mill
with a 0.50 mm mesh size, resulting in the R-HORM test ingredient.
2.2. Diet preparation
Seven experimental diets were fed in this trial. Two isocaloric,
isonitrogenous diets were formulated: 1) one control diet containing
80 g/kg herring meal and 50 g/kg herring oil and 2) one diet that
contained the same ingredients as the control diet, as well as HORM at
an 80 g/kg inclusion level (Table 2). All other feed ingredients were
typical of feed production used in rainbow trout diets and each diet was
balanced to be 40% available crude protein and 4400 kcal digestible
energy (DE)/kg to meet requirements for rainbow trout (NRC, 2011).
To make the remaining experimental diets, the HORM in the second
diet was replaced with one of the other five test ingredients listed in
Section 2.1 (water-soaked HORM, pectinase HORM, Superzyme HORM,
HP-SZ HORM, R-HORM; Table 3).
All feeds were mixed and steam-pelleted at the Chute Nutrition
Centre, Dalhousie University, Faculty of Agriculture (Truro, NS,
Canada). A Hobart mixer (Hobart Corporation; Model L-800; Troy, OH,
USA) was used to mix diets. The diets were then steam-pelleted in a
S.A. Collins et al. Aquaculture 483 (2018) 27–37
28
laboratory-scale pellet mill (California Pellet Mill Co., Crawfordsville,
Indiana, USA), using a 4 mm die. After pelleting, the feed was dried for
3 h at 55 °C in a forced air oven, sifted to remove any fines, and stored
at −20 °C.
2.3. Fish husbandry
This 112-day trial was conducted using 603 rainbow trout (initial
weight: 33.7 ± 0.3 g) in the Aquaculture Centre at Dalhousie
University, Faculty of Agriculture (Truro, NS, Canada). Fish were ran-
domly assigned to experimental tanks (30 fish/tank) in a 21-tank
(210 L/tank), freshwater, flow-through system that was provided with
continuous aeration and a flow of nitrogen degassed water at a rate of
approximately 3 L/min/tank. Water temperature was maintained at
11 ± 2 °C and recorded daily. Fish were hand-fed three times daily,
seven days per week, to apparent satiety. The light control program was
ambient daylight (August 13, 2014–December 3, 2014) with the
duration of light decreasing from the time 0 (light on at 0600 h and off
at 1830 h) to 16 weeks (light on at 0745 h and off at 1700 h).
Tanks were purged twice daily to remove accumulated excreta. Any
mortalities (three fish in total – all fed the Superzyme HORM dietary
treatment) were removed immediately and their body weights and tank
feed weights were recorded. To acclimate the fish to their tanks, the
control diet was fed to all experimental fish in the housing system for
one week prior to the experimental start date. After the acclimation
period, the seven experimental diets were randomly assigned to the
tanks of fish (3 replicates/treatment). Fish were cared for in accordance
with the guidelines of the Canadian Council on Animal Care (2005)
under the approved Dalhousie University, Faculty of Agriculture An-
imal Care and Use Committee Protocol # 2014-021.
Table 1
Chemical composition (as fed basis) of experimental ingredients.
Composition HORM Water-soaked HORM Superzyme HORM Pectinase HORM HP-SZ HORM Autoclaved HORM/wheat R. HORM
Dry matter (%) 89.76 94.63 96.02 96.36 96.06 94.26 95.11
Crude protein (%) 34.29 34.82 34.50 33.84 33.72 28.78 26.63
Essential amino acids
Arginine 2.69 2.65 2.56 2.54 2.55 NA 1.79
Histidine 0.79 0.80 0.78 0.77 0.78 NA 0.56
Isoleucine 1.17 1.28 1.25 1.24 1.25 NA 0.94
Leucine 2.13 2.28 2.22 2.19 2.21 NA 1.65
Lysine 1.67 1.62 1.56 1.57 1.64 NA 1.11
Methionine 0.60 0.61 0.59 0.58 0.60 NA 0.42
Phenylalanine 1.39 1.36 1.31 1.32 1.32 NA 1.03
Threonine 1.40 1.41 1.39 1.38 1.39 NA 1.04
Tryptophan 0.45 0.43 0.39 0.41 0.39 NA 0.30
Valine 1.64 1.81 1.76 1.74 1.75 NA 1.35
Non-essential amino acids
Alanine 1.49 1.63 1.64 1.60 1.58 NA 1.25
Aspartate 2.77 2.72 2.71 2.80 2.82 NA 1.99
Cysteine 0.73 0.74 0.72 0.74 0.71 NA 0.55
Glutamate 5.29 5.60 5.54 5.47 5.32 NA 4.33
Glycine 1.71 1.84 1.80 1.78 1.77 NA 1.28
Hydroxylysine 0.03 0.04 0.07 0.06 0.06 NA 0.03
Hydroxyproline 0.36 0.26 0.13 0.00 0.00
NA 0.00
Lanthionine 0.00 0.04 0.03 0.03 0.05 NA 0.03
Ornithine 0.01 0.10 0.12 0.16 0.17 NA 0.01
Proline 1.57 1.70 1.63 1.66 1.65 NA 1.32
Serine 1.49 1.49 1.49 1.51 1.44 NA 1.14
Taurine 0.06 0.02 0.02 0.02 0.02 NA 0.03
Tyrosine 0.87 0.82 0.81 0.80 0.77 NA 0.68
Crude fat (%) 14.59 18.50 19.13 20.61 19.93 16.78 18.50
Gross energy (kcal/kg) 5093 5254 5351 5461 5398 5088 4946
Ash (%) 4.91 5.30 5.29 5.16 5.28 4.36 4.14
Calcium (%) 15.55 0.38 0.41 0.40 0.40 0.29 0.38
Copper (ppm) 8.80 10.86 11.09 10.35 10.52 8.44 10.86
Magnesium (%) 0.41 0.42 0.42 0.41 0.41 0.35 0.42
Manganese (ppm) 35.30 40.12 39.68 38.58 38.69 41.69 40.12
Phosphorus (%) 1.01 1.03 1.02 1.01 1.00 0.88 1.03
Potassium (%) 1.21 1.19 1.21 1.18 1.20 1.04 1.19
Sodium (%) ND 0.05 0.04 0.03 0.04 ND 0.05
Zinc (ppm) 76.04 76.52 247.95 75.32 227.76 69.48 76.52
Total glucosinolates (μMol/g meal) 9.1 0.0 0.3 0.0 0.2 0.3 0.2
9-methyl-sulfinyl-nonyl (μMol/g meal) 23.0 0.0 0.0 0.0 0.0 3.3 0.8
10-methyl-sulfinyl-decyl (μMol/g meal) 3.9 0.0 0.3 0.1 0.2 0.5 0.0
11-methyl-sulfinyl-undecyl (μMol/g meal) 35.9 0.0 0.0 0.0 0.0 5.2 1.0
Total NSP 20.23 22.33 21.29 21.63 21.32 19.79 18.69
Rhamnose 0.75 0.88 0.85 0.81 0.85 0.67 0.60
Arabinose 2.95 3.23 3.12 3.05 3.06 2.96 2.93
Xylose 1.01 1.12 1.03 1.06 1.04 1.63 1.94
Mannose 0.53 0.71 0.57 0.60 0.56 0.51 0.51
Galactose 2.62 2.93 2.73 2.75 2.68 2.26 1.98
Glucose 6.52 7.18 6.78 6.99 6.73 6.42 6.17
Uronic acids 5.85 6.27 6.23 6.36 6.40 5.34 4.56
HORM = High oil residue camelina meal.
NA = Not analyzed.
ND = Not detected.
NSP = Non-starch polysaccharides.
S.A. Collins et al. Aquaculture 483 (2018) 27–37
29
Table 2
Ingredient and analyzed nutrient composition (as fed basis) of experimental diets.
Composition Control HORM Water-soaked HORM Superzyme HORM Pectinase HORM HP-SZ HORM R HORM
Ingredient (g/kg, as fed)
HORM 0.0 80.0 0.0 0.0 0.0 0.0 0.0
Water-soaked HORM 0.0 0.0 80.0 0.0 0.0 0.0 0.0
Superzyme HORM 0.0 0.0 0.0 80.0 0.0 0.0 0.0
Pectinase HORM 0.0 0.0 0.0 0.0 80.0 0.0 0.0
HP-SZ HORM 0.0 0.0 0.0 0.0 0.0 80.0 0.0
R. HORM 0.0 0.0 0.0 0.0 0.0 0.0 80.0
Herring meal 80.0 80.0 80.0 80.0 80.0 80.0 80.0
Canola oil 210.0 180.0 180.0 180.0 180.0 180.0 180.0
Corn protein concentratea 186.0 150.9 150.9 150.9 150.9 150.9 150.9
Herring oil 50.0 50.0 50.0 50.0 50.0 50.0 50.0
Ground wheat 100.0 100.0 100.0 100.0 100.0 100.0 100.0
Blood meal 110.9 145.1 145.1 145.1 145.1 145.1 145.1
Poultry by-product meal 199.1 150.0 150.0 150.0 150.0 150.0 150.0
Dicalcium phosphate 21.9 21.9 21.9 21.9 21.9 21.9 21.9
Betaineb 10.0 10.0 10.0 10.0 10.0 10.0 10.0
Phytase 5.0 5.0 5.0 5.0 5.0 5.0 5.0
Choline chloridec 3.0 3.0 3.0 3.0 3.0 3.0 3.0
Pigment premixd 2.5 2.5 2.5 2.5 2.5 2.5 2.5
Vitamin/mineral premixe 2.0 2.0 2.0 2.0 2.0 2.0 2.0
L-Lysinef 0.5 0.5 0.5 0.5 0.5 0.5 0.5
Total 1000.0 1000.0 1000.0 1000.0 1000.0 1000.0 1000.0
Nutrients (as fed)
Dry matter (%) 94.8 94.9 94.7 94.0 94.7 94.4 95.3
Crude protein (%) 47.9 46.3 47.1 47.1 45.7 46.7 46.1
Essential amino acids
Arginine 2.31 2.27 2.18 2.34 2.26 2.24 2.12
Histidine 1.56 1.69 1.65 1.64 1.69 1.67 1.60
Isoleucine 1.49 1.33 1.35 1.44 1.33 1.34 1.26
Leucine 5.70 5.43 5.40 5.32 5.33 5.35 5.14
Lysine 2.65 2.70 2.62 2.77 2.74 2.72 2.60
Methionine 0.91 0.86 0.88 0.88 0.84 0.88 0.84
Phenylalanine 2.53 2.47 2.46 2.45 2.42 2.47 2.38
Threonine 1.73 1.67 1.63 1.75 1.65 1.65 1.57
Tryptophan 0.50 0.51 0.50 0.52 0.47 0.53 0.67
Valine 2.73 2.82 2.76 2.78 2.82 2.81 2.68
Non-essential amino acids
Alanine 3.69 3.50 3.44 3.45 3.46 3.46 3.36
Aspartate 3.99 4.05 3.92 4.05 4.02 4.03 3.84
Cysteine 0.55 0.55 0.55 0.62 0.53 0.55 0.52
Glutamate 7.23 6.65 6.73 6.86 6.44 6.68 6.41
Glycine 2.83 2.68 2.54 2.73 2.70 2.62 2.59
Hydroxylysine 0.08 0.06 0.06 0.07 0.07 0.07 0.07
Hydroxyproline 0.69 0.07 0.00 0.08 0.00 0.00 0.00
Lanthionine 0.05 0.05 0.05 0.03 0.09 0.03 0.03
Ornithine 0.03 0.02 0.03 0.07 0.04 0.03 0.02
Proline 3.19 2.87 2.82 2.85 2.77 2.73 2.73
Serine 2.22 2.16 2.11 2.26 2.05 2.16 2.06
Taurine 0.15 0.12 0.04 0.15 0.04 0.04 0.04
Tyrosine 1.68 1.53 1.50 1.62 1.46 1.52 1.45
Gross energy (kcal/kg) 6076 5815 5897 5773 5887 5852 5847
Crude fat (%) 28.9 28.9 29.9 29.2 28.4 29.5 28.8
Ash (%) 6.8 7.6 7.5 7.4 7.5 7.5 7.5
ADF (%) 13.3 12.2 14.3 11.0 17.5 14.0 16.9
NDF (%) 27.3 23.1 22.6 22.9 23.8 24.4 12.9
Calcium (%) 1.8 1.7 1.7 1.7 1.6 1.7 1.7
Phosphorus (%) 1.3 1.3 1.3 1.3 1.2 1.3 1.3
Sodium (%) 0.3 0.3 0.3 0.2 0.3 0.3 0.3
Potassium (%) 0.5 0.5 0.5 0.5 0.5 0.5 0.5
Magnesium (%) 0.1 0.1 0.1 0.1 0.1 0.1 0.1
Manganese (ppm) 134 145 142 136 143 133 137
Copper (ppm) 11 8 7 10 8 7 8
Zinc (ppm) 162 191 166 164 182 184 173
a Empyreal 75; Cargill Corn Milling; Blair, NE, USA.
b Betafin S1; Finnfeeds Finland Oy; Satamatie 2, 21100 Naantali, Finland.
c Choline chloride 60%; Jefo Nutrition Inc.; Saint-Hyacinte, QC, Canada.
d Vitamin/mineral premix contains (/kg): zinc, 77.5 mg; manganese, 125 mg; iron, 84 mg; copper, 2.5 mg; iodine, 7.5 mg; vitamin A, 5000 IU; vitamin D, 4000 IU; vitamin K, 2 mg;
vitamin B12, 4 μg; thiamine, 8 mg; riboflavin, 18 mg; pantothenic acid, 40 mg; niacin, 100 mg; folic acid, 4 mg; biotin, 0.6 mg; pyridoxine, 15 mg; inositol, 100 mg; ethoxyquin, 42 mg;
wheat shorts, 1372 mg.
e Pigment premix contains (/kg): selenium, 0.220 mg; vitamin E, 250 IU; vitamin C, 200 mg; astaxantin, 60 mg; wheat shorts, 1988 mg.
f
L-Lysine HCl 78.8%; Jefo Nutrition Inc.; Saint-Hyacinte, QC, Canada.
S.A. Collins et al. Aquaculture 483 (2018) 27–37
30
2.4. Growth response and related factors
During the 112 day growth trial, the fish were batch weighed at
28 day intervals and their feed intake data was recorded. For each
28 day period and for the entirety of the experiment, growth response
and feed intake parameters were calculated.
The following formulae were used to calculate mean body weight,
weight gain, specific growth rate (SGR), thermal growth coefficient
(TGC), mean feed consumption, feed conversion ratios (FCR) and pro-
tein efficiency ratio (PER), hepatosomatic index (HSI), viscerosomatic
index (VSI): mean body weight = total body weight / number of fish;
weight gain = final body weight − initial body weight; SGR = ((ln
(final body weight) − ln (initial body weight)) / number of days in
period) ∗ 100; TGC = [( −final weight initial weight3 3 ) / temperature
in °C ∗ time in days] ∗ 1000; mean feed consumption = (initial weight
of feed − final weight of feed) / number of fish; FCR = (initial weight
of feed − final weight of feed) / (final body weight − initial body
weight); PER = (final body weight − initial body weight) / (feed con-
sumed ∗ percentage of protein in feed); HSI = liver weight / body
weight ∗ 100; VSI = viscera weight / body weight ∗ 100.
2.5. Tissue sampling
On days 0, 56 and 112, four fish per tank were euthanized by an
overdose (in excess of 300 mg/L) of tricaine methanesulfonate
(MS222). To collect samples for histological and real-time quantitative
polymerase chain reaction (qPCR) analyses, an incision was made along
the ventral midline of each fish and the digestive tract, from esophagus
to anus, and all attached organs (excluding the heart and kidney) were
carefully removed and weighed.
A 2 cm section of the hindgut sample was taken from the section of
intestine located approximately 2 cm from the most distal point of the
intestinal tract. This section was then cut in two. The most anterior
portion was gently compressed to release any digesta, then placed in a
DNAse-free, RNAse-free snap-cap vial and flash frozen in liquid ni-
trogen, stored at −80 °C, then couriered to the Ocean Sciences Centre
(OSC) of Memorial University of Newfoundland (St. John's, NL,
Canada) for RNA isolation and qPCR analysis. The more distal portions
of the hindgut samples were placed in scintillation vials filled with 10%
neutral phosphate-buffered formalin (3.7% formaldehyde) for histolo-
gical analysis.
The four carcasses from each tank (viscera and kidneys removed)
were pooled and ground using a commercial hand-operated meat
grinder with a 4 mm die, then freeze-dried using a ModulyoD freeze
dryer
(Thermo Fisher Scientific).
2.6. Chemical analysis
Representative ingredient and feed samples, as well as the freeze-
dried fish tissue samples were ground using a coffee grinder to a par-
ticle size of 1 mm. The percent moisture content of the freeze-dried
samples was determined by comparing the weights of each sample
before and after freeze-drying using the following calculation: (%
moisture = ((wet weight-dry weight) / wet weight) ∗ 100). The percent
moisture content of the feeds and ingredients was determined (AOAC,
2005, method no. 934.01). Samples were analyzed for dry matter (100-
moisture), crude protein (AOAC, 2005; method no. 990.03; using a Leco
protein/N analyzer (Model FP-528, Leco Corp., St. Joseph, MI, USA)),
ash (AOAC, 2005; method no. 942.05), crude fat (AOCS, 2005; method
Am 5-04; using an ANKOM XT15 extraction system (ANKOM Tech-
nology, Macedon, NY, USA)) and mineral composition (AOAC, 2003;
method no. 968.08). Energy was determined using an isoperibol oxygen
bomb calorimeter (Parr Adiabatic Calorimeter, Model 6300, Parr In-
strument Co., Moline, IL, USA) with a water recirculation system
(Model 6520A, Parr Instrument Co., Moline, IL, USA).
The total non-starch polysaccharide composition of the experi-
mental ingredients was determined at the University of Manitoba,
Department of Animal Science (Winnipeg, MB, Canada) using the
method of Slominski et al. (2012). The acid detergent fiber (ADF) and
neutral detergent fiber (NDF) content of the test diets were analyzed
using ANKOM A200 Fiber Analyzer & Fiber bag Technology (ANKOM
Technology Methods 5 and 6, respectively). The complete amino acid
profile of the experimental ingredients and diets was determined
(AOAC, 2006; method no. 982.30 E (a,b,c), chp. 45.3.05) at the Uni-
versity of Missouri – Columbia, College of Agriculture, Food and Nat-
ural Resources, Agricultural Experiment Station Chemical Laboratories
(Columbia, MO, USA).
The glucosinolate composition of the experimental ingredients was
Table 3
Primers used in QPCR studies.
Gene name
(GenBank Acc. No.)
Nucleotide sequence (5′-3′) bEfficiency (%) Amplicon size (bp)
GILT1
(BX084210)
CTACTTCCTCACCTCACAGCT 108 149
CAAGACACTCTTCTTCGCCGT
GILT2
(BX863407)
CCTACGGAAATGCACACGAGT 91 129
GGAATGCTTTGCTTCCTGTAGC
PAR2A
(BX861951)
TCCCTGAGGAACTCCATGAC 109 104
GGGTGAAAACAGACCAGGAA
PAR2B
(BX862553)
GTGGCCCATCCTCTATCTCA 102 106
ACAGGTACAGAGGGGTGGTG
IL1β3
(AJ557021)
AAAACGGTTCGCTTCCTCTT 100 102
CTCCAGTGAGGTGCTGATGA
MyD88
(NM_001124421)
CATGTGTCTGGACCATCACC 91 119
GAGGGCAAACTTTGTCTGGA
TGFβ1a
(KF870471)
CCAGTAAGCACCAGATTCTCTT 90 118
TCGTCGAGCAGGCCATGGTT
TGFβ1b
(KF870472)
GAAGCAGGATAAGAATGTCACC 100 135
CCAGACGGGATGTTAGTGGTT
aEF1α
(CF752140)
CTTTGTGCCCATCTCTGGAT 98 122
CCAGCAGAGTCACACCATTG
aβ-actin
(AF157514)
AGAGCTACGAGCTGCCTGAC 95 104
GCAAGACTCCATACCGAGGA
a Normalizers.
b Amplification efficiencies were calculated using a 5-point or a 4-point (TGFβ1a only) 1:3 dilution series starting with cDNA representing 10 ng of input total RNA. See Materials and
methods for details.
S.A. Collins et al. Aquaculture 483 (2018) 27–37
31
determined at the Saskatoon Research Centre (Agriculture and Agri-
Food Canada, Saskatoon, SK, Canada) using the method of Daun and
McGregor (1981), according to Lange and Schumann (1995). Benzyl
glucosinolate was used as an internal standard.
2.7. Histology
Histology slides were prepared at the Animal Health Laboratory,
Agriculture and Food Operations Branch (Nova Scotia Department of
Agriculture, Truro, NS, Canada). 5 μm cross-sectional sections of in-
testinal tissues were formalin-fixed, embedded and stained using the
wax tissue processing method of Drury and Wallington (1980). A de-
tailed description of how this procedure was carried out and how
images of these slides were scanned and captured is described in
Bullerwell et al. (2016).
Points of measurement are shown in Fig. 1. Villi that were de-
termined measurable were fully visible from tip to the submucosa and
had no shattered edges. For each suitable villus, the following data were
collected: villus length, villus width, villus area, lamina propria length,
lamina propria width, lamina propria area and crypt depth. Villus width
and lamina propria width were measured at the midpoint of each villus.
Crypt depth was measured from the top of the crypt to the inner edge of
the muscularis mucosae. Intestinal wall (inner edge of the muscularis
mucosae to the outer edge of the serosa) thickness was also measured at
10 evenly spaced points around the intestinal sample. Data was col-
lected from as many villi as possible - up to 10 villi per slide and no
fewer than five. If there were> 10 suitable villi on a slide, the villi
selected for measurement were as evenly spaced around the intestine
lumen as possible. Slides with fewer than six suitable villi were con-
sidered damaged samples and were excluded from measurement.
The following ratios, comparing the lamina propria within each
villus, were determined - lamina propria length: villus length; lamina
propria width: villus width; lamina propria area: villus area.
2.8. RNA preparation
Frozen tissue samples (hindgut) were homogenized using a mortar
and pestle as in Brown et al. (2016) to generate a homogeneous
powder. Approximately 100 mg tissue was transferred to a nuclease-
free 1.5 mL microcentrifuge tube, 800 μl of TRIzol Reagent (Invitrogen/
Life Technologies, Burlington, ON) was added and the homogenate was
mixed by pipette. The samples were then stored at −80 °C for
~1 week. The samples were removed from the freezer, thawed on ice
and then further disrupted using QIAshredder spin columns (QIAGEN,
Mississauga, ON) following the manufacturer's instructions. The
samples were topped up to ~1 mL with 200 μl of TRIzol Reagent and
the total RNA extractions were then completed following the manu-
facturer's instructions.
The TRIzol extracted total RNA samples (45 μg) were treated with
6.8 Kunitz units DNaseI (RNase-Free DNase Set, QIAGEN) with the
manufacturer's buffer (1× final concentration) at room temperature for
10 min to degrade any residual genomic DNA. The DNase-treated RNA
samples were then column-purified using the RNeasy MinElute Cleanup
Kit (QIAGEN) following the manufacturer's instructions. RNA integrity
was verified by 1% agarose gel electrophoresis, and purity was assessed
by A260/280 and A260/230 NanoDrop UV spectrophotometry for both
the crude and column-purified RNA extracts. Column-purified RNA
samples had A260/280 ratios between 2.0 and 2.1 and A260/230 ratios
between 2.0 and 2.4.
2.9. Real-time quantitative polymerase chain reaction (qPCR)
In the qPCR study, transcript levels of genes previously associated
with gut inflammation in fish [gamma-interferon-inducible lysosomal
thiol reductase (GILT), proteinase-activated receptor 2 (PAR2), inter-
leukin-1 beta 3 (IL1ß3), myeloid differentiation primary response gene
88 (MyD88) and transforming growth factor beta 1 (TGFß1)] were
measured (Maehr et al., 2013; Marjara et al., 2012; Mansfield et al.,
2010; Lilleng et al., 2009). A total of eight genes including paralogs
were selected for analysis (GILTa, GILTb, PAR2a, PAR2b, IL1ß3,
MyD88, TGFß1a and TGFß1b), and their transcript expression was
measured in hindgut samples taken from 9 individuals from each of
four diets (control, HORM, HP-SZ HORM and R-HORM).
First-strand cDNA templates for qPCR were synthesized from 1 μg of
DNaseI-treated total RNA extracted from hindgut using M-MLV reverse
transcriptase (Invitrogen/Life Technologies) as described in Caballero-
Solares et al. (2017). PCR amplifications were performed using Power
SYBR Green PCR Master Mix (Applied Biosystems/Life Technologies) as
described in Caballero-Solares et al. (2017).
The sequences of all primer pairs used in qPCR analyses and the
GenBank accession numbers of their corresponding cDNA sequences are
presented in Table 3. In the case of gene paralogs, cDNA sequences were
aligned using AlignX (Vector NTI Advance 11, Life Technologies) and
primers
were designed in regions that were paralog specific. Each
primer pair was quality tested as described in Caballero-Solares et al.
(2017). Amplification efficiencies (Pfaffl, 2001) were calculated for one
individual that had been fed the control diet and for one individual that
had been fed the HORM diet. Briefly, a 5-point 1:3 dilution series
starting with cDNA representing 10 ng of input total RNA was per-
formed in duplicate for each individual and the reported efficiencies
Fig. 1. Points of measurements for histological analysis of intestinal cross-sections: (A) villus width; (B) villus length; (C) lamina propria width; (D) lamina propria length; (E) crypt depth;
(F) intestinal wall thickness; (G) villus area; (H) lamina propria area (modified from Bullerwell et al., 2016).
S.A. Collins et al. Aquaculture 483 (2018) 27–37
32
(Table 3) are an average of the two values. All amplification efficiencies
were between 90 and 110%.
Transcript levels of the genes of interest were normalized to tran-
script levels of two endogenous control genes. To select these en-
dogenous controls, qPCR primers pairs for rainbow trout were designed
for 7 candidate normalizer genes from previous Atlantic salmon studies
in the Rise lab (e.g. Xue et al., 2015; Brown et al., 2016): 60S ribosomal
protein L32 (CF752566); β-actin (AF157514); ATP-binding cassette
(CA383423); cleavage and polyadenylation specificity factor
(FR905004); elongation factor 1-alpha (CF752140); eukaryotic trans-
lation initiation factor 3 subunit D (CU070663); polyadenylate-binding
protein (CA355003). These candidate normalizer gene primer pairs
were quality tested as described in Caballero-Solares et al. (2017). The
fluorescence threshold cycle (CT) values of sixteen individuals (4 in-
dividuals from each diet) were measured in triplicate for each of these
genes using cDNA representing 5 ng of input total RNA, and then
analyzed using geNorm (Vandesompele et al., 2002) to select the most
stably expressed transcripts. Using this software, elongation factor 1-
alpha (geNorm M = 0.215) and β-actin (geNorm M= 0.217) were
determined to be the most stable. As such, expression levels of the
transcripts of interest (TOIs) were normalized to transcript levels of
both genes.
When primer quality testing and normalizer selection were com-
pleted, qPCR analyses of transcript (mRNA) expression levels were
performed using the ViiA 7 Real Time PCR system (384-well format)
(Applied Biosystems/Life Technologies). In all cases, cDNA re-
presenting 5 ng of input total RNA was used as template in the PCR
reactions. On each plate, for every sample, the TOIs and endogenous
controls were tested in triplicate, and a plate linker sample (i.e. a
sample that was run on all plates in a given study) and a no-template
control were included. The relative quantity (RQ) of each transcript was
determined using the ViiA 7 Software Relative Quantification Study
Application (Version 1.2.3) (Applied Biosystems/Life Technologies),
with normalization to both elongation factor 1-alpha and β-actin, and
with amplification efficiencies incorporated. For each TOI, the sample
with the lowest normalized expression (mRNA) level was set as the
calibrator sample (i.e. assigned an RQ value = 1).
2.10. Statistical analysis
This experiment was conducted as a completely randomized design.
The General Linear Model procedure of IBM SPSS 20.0 (SPSS Inc.,
Chicago, IL, USA) was used for statistical analysis. Tank was the ex-
perimental unit for all growth and feed intake parameters measured.
Fish was the experimental unit for all histological parameters and TOIs
measured. All data are expressed as mean ± standard error.
For growth feed intake and histological parameters, differences
between means were calculated using the Ryan-Einot-Gabriel-Welsch F-
test. For all of the TOIs, expression data exhibited homogeneity of
variance. Therefore, a one-way ANOVA followed by Tukey's B post-hoc
test was used to assess if there were any significant differences in
transcript levels for a given gene of interest in the hindgut of fish fed
different diets. Means were considered significantly different when
P < 0.05.
3. Results
During the 16 week study, there were no significant differences in
body weight and weight gain among the seven treatments in the first four
weeks or in the last eight weeks. However, from days 28–56, fish fed the
water-soaked HORM and R-HORM diets gained significantly less weight
(73.3 and 73.4 g, respectively) than fish fed the control diet (89.2 g).
Early in the trial (days 0–28), treatment had a significant effect on
SGR and TGC. Fish fed the HORM diet and the R-HORM diet had a
significantly lower SGR (3.8 and 3.7, respectively) than fish fed the
control diet (4.1). The TGC of control-fed fish (4.3) was significantly
higher than the TGC of fish fed the R-HORM diet (3.8). There were no
significant differences for feed consumption, feed conversion ratio, and
PER among treatments for the entirety of the experimental period
(Table 4).
There were significant differences in fork length at both the mid-
point and final measurements of the study. At the mid-point, the fork
length of fish fed the water-soaked diet was the shortest (22.2 cm), the
fork length of fish fed the R-HORM diet was the second shortest
(22.1 cm) and the fork length of fish fed the control diet was longest
(23.3 cm). At the end of the study, the fork length of fish fed the water-
soaked HORM diet was longer than that of fish fed the R-HORM diet
(29.3 cm versus 27.7 cm, respectively). There were no significant dif-
ferences in fork length between fish fed the other five diets (Table 4).
HSI (days 56 and 112) and VSI (day 112) were both similar among all
treatments (Table 4).
Carcass proximate (crude protein, crude fat ash) and mineral com-
position was similar among treatments (Table 5). For most of the his-
tological parameters measured, there were no significant differences
among treatments. However, fish fed the HP-SZ HORM diet had sig-
nificantly longer lamina propria and a significantly larger lamina pro-
pria area than fish fed the Pectinase HORM diet (0.43 vs 0.31 μm and
0.04 vs 0.02 μm2, respectively). Fish fed the HP-SZ HORM diet also had
significantly longer villi and a significantly larger villus area than fish
fed the Pectinase HORM diet (0.49 vs 0.36 μm and 0.07 vs 0.05 μm2,
respectively). Additionally, fish fed the HP-SZ HORM diet also had
significantly wider villi than fish fed the control diet (0.15 μm vs
0.12 μm) (Table 5). There were no significant differences in transcript
levels of the eight inflammatory biomarker genes in fish fed the HORM,
HP-SZ HORM or R-HORM diets, compared with fish fed the control diet
(Fig. 2).
4. Discussion
Surface activated biofermentation with the use of R. oligosporus has
been effective on lupin, which is a plant with large seeds (Ortega-David
and Rodriguez-Stouvenel, 2014). However, it was less effective on the
HORM in initial product development, which is why the HORM was
combined with wheat to produce the R-HORM. The camelina seed is
much smaller than lupin seed, with less air space between particles,
which may have caused poor contact between the HORM and the R.
oligosporus fungi. Because of this, however, the protein and overall
nutrient composition of this feed ingredient was lower than that of the
other camelina products (Table 1). Additionally, the essential amino
acid composition of the R-HORM diet was lower than the other ex-
perimental diets (Table 2), which may account for the significantly
lower SGR of fish fed the R-HORM diet (2.2) as compared with that of
the control-fed fish (2.4), as well as their reduced SGR and TGC from
days 0–28 and weight gain from days 28–56, as compared with fish fed
the control diet (P > 0.05).
Water treatment reduced the glucosinolate levels of HORM from
9.1 μMol/g meal to 0.0 μMol/g meal, but increased the total non-starch
polysaccharide (NSP) content from 20.23% to 22.33% (Table 1). The
HP-SZ and R-HORM were the only two ingredients
with lower total NSP
than the HORM (19.79% and 18.67%, respectively). The combination
of enzymes in the High-Pectinase Superzyme™-OM Concentrate in ad-
dition to pectinase were more efficient than the Pectinase product at
reducing the total NSP of the HORM. This may also have had an impact
on the villi of rainbow trout fed these diets, as villi of HP-SZ-fed fish
were longer and wider with a larger area than those of the Pectinase
HORM-fed fish and the lamina propria within these villi were also
longer with a larger area (P < 0.05). Signs of enteritis associated with
the NSP content of feed, including changes in gut physiology, mor-
phology and microbial population have been identified in salmonids
(Sinha et al., 2011), however to further explore and confirm this con-
cept, future studies may involve analyzing these samples for water-so-
luble and water-insoluble NSP, as well as individual NSP.
S.A. Collins et al. Aquaculture 483 (2018) 27–37
33
There was no difference in feed consumption among treatments
(P > 0.05), which indicates there was no feed aversion due to the
presence of glucosinolates in the diet. The glucosinolates in the ex-
perimental diets were within the safe upper limit of glucosinolates in-
take for rainbow trout, which is 1.4 μMol/g (Burel et al., 2000; NRC,
2011). As an example, HORM, the ingredient with the highest con-
centration of total glucosinolates (9.1 μMol/g meal) was present in the
diet at an inclusion level of 80 g/kg, diluting the total glucosinolates in
the diet to 0.7 μMol/g feed, which is below the safe upper limit for
rainbow trout.
Brown et al. (2016) fed solvent-extracted camelina meal (SECM) to
Atlantic salmon smolts in seawater (initial weight = 242 g). The re-
searchers found Atlantic salmon fed SECM at a dietary inclusion level of
80 g/kg for 16 weeks had lower final weights, lower weight gain,
higher VSI and a lower feed intake than control-fed fish. In this same
study, fish fed SECM at dietary inclusion levels of 160 and 240 g/kg,
exhibited significant changes in lamina propria width as compared with
fish fed the control and 80 g/kg SECM diets. There was little evidence of
inflammation from the histological data and no evidence of in-
flammation from the gene expression results in the current study.
As with the current study, Brown et al. (2016) found no difference
in GILT transcript expression in the distal intestines of fish fed 8%
versus 0% camelina meal (CM). However, while the current study found
no response of TGFβ transcript expression to 8% CM diets, Brown et al.
(2016) found that TGFβ transcript was significantly upregulated in
distal intestines of fish fed the 8% CM diet versus the control.
Table 4
Growth, feed intake and related parameters of rainbow trout fed experimental diets (n = 3).
Parameter Control HORM Water-soaked HORM Superzyme HORM Pectinase HORM HP-SZ HORM R. HORM
Initial body weight (g/fish) 33.1 ± 0.4 33.1 ± 0.4 33.1 ± 0.4 33.1 ± 0.4 33.1 ± 0.4 33.1 ± 0.4 33.1 ± 0.4
Weight gain (g/fish)
Day 0–28 71.4 ± 2.6 62.8 ± 2.7 63.0 ± 6.0 67.3 ± 0.4 66.2 ± 2.1 66.9 ± 5.5 61.9 ± 4.1
Day 28–56 89.2 ± 3.2a 75.4 ± 3.6ab 73.3 ± 3.0b 79.8 ± 7.9ab 78.7 ± 3.4ab 79.0 ± 3.6ab 73.4 ± 9.0b
Day 56–84 158.1 ± 16.2 138.6 ± 2.4 154.7 ± 9.7 143.7 ± 4.0 144.0 ± 10.7 149.3 ± 2.6 135.5 ± 17.4
Day 84–112 133.2 ± 17.0 123.1 ± 4.0 122.1 ± 7.1 123.0 ± 2.5 128.0 ± 5.5 126.2 ± 5.3 112.7 ± 20.7
Total (Day 0–112) 451.9 ± 25.3 399.8 ± 4.7 413.1 ± 19.8 413.7 ± 13.3 416.9 ± 20.1 421.4 ± 3.1 383.5 ± 49.6
SGR
Day 0–28 4.1 ± 0.1a 3.8 ± 0.1b 3.8 ± 0.2ab 3.9 ± 0.0ab 3.9 ± 0.0ab 3.9 ± 0.2ab 3.7 ± 0.1b
Day 28–56 2.2 ± 0.1 2.1 ± 0.1 2.0 ± 0.1 2.1 ± 0.2 2.1 ± 0.1 2.1 ± 0.2 2.0 ± 0.1
Day 56–84 2.1 ± 0.2 2.1 ± 0.1 2.3 ± 0.1 2.1 ± 0.0 2.1 ± 0.1 2.2 ± 0.1 2.1 ± 0.1
Day 84–112 1.1 ± 0.1 1.2 ± 0.1 1.1 ± 0.1 1.2 ± 0.0 1.2 ± 0.1 1.2 ± 0.1 1.1 ± 0.1
Total (Day 0–112) 2.4 ± 0.1a 2.3 ± 0.0ab 2.3 ± 0.1ab 2.3 ± 0.0ab 2.3 ± 0.0ab 2.3 ± 0.0ab 2.2 ± 0.1b
TGC
Day 0–28 4.3 ± 0.1a 3.9 ± 0.1ab 3.9 ± 0.3ab 4.0 ± 0.0ab 4.0 ± 0.1ab 4.0 ± 0.2ab 3.8 ± 0.1b
Day 28–56 3.2 ± 0.1 2.9 ± 0.1 2.8 ± 0.1 2.9 ± 0.2 2.9 ± 0.1 2.9 ± 0.1 2.9 ± 0.2
Day 56–84 3.0 ± 0.4 3.7 ± 0.1 2.8 ± 2.4 3.7 ± 0.1 3.8 ± 0.2 3.9 ± 0.1 3.7 ± 0.2
Day 84–112 2.6 ± 0.3 2.6 ± 0.1 2.6 ± 0.2 2.6 ± 0.1 2.7 ± 0.1 2.6 ± 0.1 2.5 ± 0.2
Total (Day 0–112) 3.5 ± 0.1 3.3 ± 0.0 3.4 ± 0.1 3.3 ± 0.1 3.4 ± 0.1 3.4 ± 0.0 3.2 ± 0.2
Feed consumption (g/fish)
Day 0–28 53.8 ± 1.6 51.1 ± 5.4 51.6 ± 3.7 54.5 ± 0.9 51.8 ± 2.1 52.8 ± 3.3 53.3 ± 4.2
Day 28–56 106.8 ± 1.6 99.0 ± 1.0 98.8 ± 10.4 109.3 ± 5.7 100.3 ± 4.7 105.0 ± 5.7 99.1 ± 10.7
Day 56–84 139.5 ± 6.2 127.5 ± 3.2 151.5 ± 8.7 144.8 ± 8.1 140.8 ± 17.8 153.0 ± 16.6 140.6 ± 17.1
Day 84–112 173.5 ± 21.1 145.6 ± 20.5 169.6 ± 4.6 162.2 ± 4.8 176.1 ± 19.9 161.1 ± 28.8 158.3 ± 15.7
Total (Day 0–112) 473.5 ± 25.8 423.1 ± 26.7 471.4 ± 21.2 470.6 ± 14.9 469.0 ± 35.6 471.9 ± 50.8 451.2 ± 43.7
FCR
Day 0–28 0.8 ± 0.1 0.8 ± 0.1 0.8 ± 0.0 0.8 ± 0.0 0.8 ± 0.0 0.8 ± 0.0 0.9 ± 0.0
Day 28–56 1.2 ± 0.1 1.3 ± 0.1 1.3 ± 0.1 1.4 ± 0.2 1.3 ± 0.0 1.3 ± 0.1 1.4 ± 0.0
Day 56–84 0.9 ± 0.1 0.9 ± 0.0 1.0 ± 0.0 1.0 ± 0.0 1.0 ± 0.1 1.0 ± 0.1 1.0 ± 0.0
Day 84–112 1.3 ± 0.1 1.1 ± 0.2 1.4 ± 0.1 1.3 ± 0.1 1.4 ± 0.1 1.3 ± 0.2 1.4 ± 0.1
Total (Day 0–112) 1.1 ± 0.0 1.1 ± 0.1 1.1 ± 0.1 1.1 ± 0.0 1.1 ± 0.0 1.1 ± 0.1 1.2 ± 0.0
PER
Day 0–28 2.8 ± 0.2 2.7 ± 0.2 2.6 ± 0.1 2.6 ± 0.1 2.8 ± 0.1 2.7 ± 0.1 2.5 ± 0.1
Day 28–56 1.8 ± 0.1 1.6 ± 0.1 1.6 ± 0.1 1.6 ± 0.2 1.7 ± 0.1 1.6 ± 0.1 1.6 ± 0.0
Day 56–84 2.4 ± 0.2 2.4 ± 0.1 2.4 ± 0.1 2.1 ± 0.1 2.3 ± 0.1 2.1 ± 0.2 2.1 ± 0.0
Day 84–112 1.6 ± 0.1 1.9 ± 0.3 1.5 ± 0.1 1.6 ± 0.1 1.6 ± 0.1 1.7 ± 0.3 1.5 ± 0.1
Total (Day 0–112) 2.0 ± 0.0 2.1 ± 0.2 1.9 ± 0.1 1.9 ± 0.1 2.0 ± 0.1 1.9 ± 0.2 1.8 ± 0.1
Fork length
Day 56d 23.3 ± 1.0a 22.2 ± 1.1abc 21.8 ± 0.9c 22.7 ± 0.8abc 23.0 ± 0.8ab 22.8 ± 1.1abc 22.1 ± 0.9bc
Day 112e 29. ± 2.1a 28.8 ± 1.5ab 29.3 ± 1.6a 28.7 ± 1.7ab 29.0 ± 1.5ab 29.2 ± 1.2a 27.7 ± 1.6b
HSI
Day 56d 1.6 ± 0.3 1.6 ± 0.2 1.9 ± 0.8 1.6 ± 0.3 1.6 ± 0.2 1.6 ± 0.2 1.7 ± 0.2
Day 112e 1.4 ± 0.3 1.4 ± 0.3 1.3 ± 0.3 1.4 ± 0.3 1.4 ± 0.2 1.3 ± 0.2 1.3 ± 0.2
VSI
Day 112d 13.1 ± 1.8 13.3 ± 1.1 13.8 ± 2.0 14.6 ± 2.4 13.1 ± 1.5 12.4 ± 2.1 13.8 ± 2.1
abMeans within rows with different superscripts are significantly different (P < 0.05).
HSI D0 = 1.5 ± 0.3 (n= 12).
VSI D0 = 12.8 ± 4.2 (n = 6).
abcMeans within rows with different superscripts are significantly different (P < 0.05).
dn = 12.
en= 24.
S.A. Collins et al. Aquaculture 483 (2018) 27–37
34
Differences in performance and distal intestine TGFβ transcript ex-
pression results between the fish in this experiment and in those studied
in Brown et al. (2016) may have been due to multiple reasons, in-
cluding differences in camelina meal product (SECM vs HORM), dif-
ferences in species (Atlantic salmon vs rainbow trout), differences in life
stage (242 g vs 33 g in the present study) and differences in water en-
vironment (fresh vs salt).
The data presented by Ye (2014) offers a comparison with the re-
search presented herein with respect to similarities in camelina meal
product and body weight, but differences in species. HORM was fed to
Atlantic salmon post-smolts (initial weight = 61 g; final
weight = 191–439 g, depending on dietary treatment) in freshwater at
dietary inclusion levels of 0, 80, 160 and 240 g/kg for 16 weeks. In-
creases in dietary inclusion level led to subsequent decreases of final
weight, weight gain, SGR and feed consumption, with each subsequent
increase in HORM leading to a significant decrease in fish performance.
The FCR for fish fed 240 g/kg HORM in their diet was significantly
higher than that of fish fed the other three diets and the FCR of fish fed
160 g/kg HORM in their diet was significantly higher than that of the
control-fed fish. There were also significant differences in histological
results, particularly for fish fed 240 g/kg HORM in the diet, and in some
cases, Atlantic salmon fed 160 g/kg HORM, where shorter, narrower
villi with smaller areas were observed in comparison with Atlantic
salmon fed diets
containing lower dietary inclusion levels of HORM.
Fish fed the 240 g/kg HORM also had a thinner intestinal wall and more
goblet cells than fish fed 0 or 80 g/kg HORM in the diet (P < 0.05).
Histologically, there was no evidence of inflammation in Atlantic
salmon fed 80 g/kg HORM in this study, as compared with control-fed
fish (P ˃ 0.05) (Ye, 2014).
Hixson et al. (2015) fed a similarly produced HORM to rainbow
trout (initial weight = 45 g) at dietary inclusion levels of 0, 70, 140 and
210 g/kg and to Atlantic salmon (initial weight = 242 g) at dietary
inclusion levels of 0, 80, 160 and 240 g/kg. These researchers observed
no difference in growth parameters in rainbow trout fed diets
containing up to 140 g/kg HORM. However, Atlantic salmon fed diets
containing 140 g/kg HORM for 16 weeks weighed significantly less
than fish fed 0 and 70 g/kg HORM.
The results of the present study, in comparison with those of Brown
et al. (2016), Hixson et al. (2015) and Ye (2014) suggest that Atlantic
salmon and rainbow trout in general respond differently to the inclu-
sion of HORM in their diets and that rainbow trout may be capable of
consuming diets containing higher levels of HORM than Atlantic
salmon. This follows in the same thread as Brown et al. (2016), who
suggested that Atlantic salmon parr are more tolerant of diets con-
taining camelina meal than Atlantic salmon post-smolts, based on a
comparison with research conducted by Ye et al. (2016), where SECM
was fed to Atlantic salmon parr (initial weight = 8 g) at dietary in-
clusion levels of 0, 50, 100 and 200 g/kg, and there were no significant
differences in final weight, weight gain or feed consumption or FCR
among treatments. This is also in keeping with research involving other
feed ingredients such as soybean meal and lupin (Refstie et al., 2000;
Glencross et al., 2004), where Atlantic salmon were found to be more
sensitive than rainbow trout.
5. Conclusion
Considering overall growth results, all feed ingredients were ac-
ceptable at a dietary inclusion level of 80 g/kg for rainbow trout at this
life stage (33–450 g), with the exception of R-HORM, which had a ne-
gative effect on SGR. Since there was no evidence of inflammation in
HORM-fed fish compared with control diet fed fish based on histology
or distal intestine inflammatory biomarker gene expression in this
study, rainbow trout at this life stage are capable of tolerating HORM in
their diet at a dietary inclusion level of 80 g/kg.
For future studies involving fermentation of HORM with R. oligos-
porus, it is recommended that the HORM be combined with a higher
protein feed ingredient. Additional suggestions would be to supplement
the diet with amino acids or an alternative dietary formulation be used.
Table 5
Mean histological measurements of hindgut samples (n = 12) and chemical composition (n= 3) of rainbow trout tissue (whole body, dry matter basis) fed experimental diets for
112 days.
Parameter Control HORM Water-soaked HORM Superzyme HORM Pectinase HORM HP-SZ HORM R. HORM
Measurements
LP length (μm) 0.37 ± 0.06ab 0.36 ± 0.06ab 0.40 ± 0.07ab 0.38 ± 0.09ab 0.31 ± 0.08b 0.43 ± 0.11a 0.41 ± 0.06ab
LP width (μm) 0.07 ± 0.01 0.07 ± 0.01 0.08 ± 0.02 0.19 ± 0.03 0.07 ± 0.01 0.08 ± 0.02 0.07 ± 0.01
LP area (μm2) 0.03 ± 0.01ab 0.03 ± 0.01ab 0.03 ± 0.01ab 0.03 ± 0.01ab 0.02 ± 0.01b 0.04 ± 0.01a 0.03 ± 0.01ab
Villus height (μm) 0.39 ± 0.15ab 0.41 ± 0.06ab 0.45 ± 0.07ab 0.44 ± 0.10ab 0.36 ± 0.09b 0.49 ± 0.11a 0.45 ± 0.06ab
Villus width (μm) 0.12 ± 0.04b 0.14 ± 0.01ab 0.14 ± 0.02ab 0.13 ± 0.02ab 0.12 ± 0.02ab 0.15 ± 0.02a 0.13 ± 0.02ab
Villus area (μm2) 0.05 ± 0.01ab 0.06 ± 0.01ab 0.06 ± 0.01ab 0.06 ± 0.02ab 0.05 ± 0.01b 0.07 ± 0.03a 0.06 ± 0.01ab
Crypt depth (μm) 0.06 ± 0.03 0.06 ± 0.02 0.05 ± 0.01 0.05 ± 0.01 0.06 ± 0.01 0.06 ± 0.01 0.06 ± 0.01
Intestinal wall thickness (μm) 0.20 ± 0.07 0.20 ± 0.08 0.19 ± 0.03 0.18 ± 0.06 0.18 ± 0.03 0.16 ± 0.09 0.19 ± 0.06
Outer wall 0.16 ± 0.06 0.16 ± 0.07 0.15 ± 0.03 0.15 ± 0.06 0.14 ± 0.03 0.12 ± 0.08 0.15 ± 0.06
Inner wall 0.04 ± 0.01 0.04 ± 0.01 0.04 ± 0.01 0.03 ± 0.01 0.04 ± 0.00 0.04 ± 0.01 0.04 ± 0.01
Ratios
LP:villus length (μm) 1.01 ± 0.35 1.13 ± 0.03 1.12 ± 0.04 1.15 ± 0.04 1.16 ± 0.04 1.14 ± 0.05 1.12 ± 0.02
LP:villus width (μm) 1.72 ± 0.56 1.90 ± 0.21 1.84 ± 0.21 1.86 ± 0.25 1.83 ± 0.15 1.84 ± 0.15 1.87 ± 0.12
LP:villus area (μm2) 1.85 ± 0.37 1.98 ± 0.20 1.89 ± 0.17 1.99 ± 0.23 2.00 ± 0.15 1.90 ± 0.12 1.89 ± 0.11
Carcass composition (%, as is)
Crude protein (%) 50.6 ± 0.1 48.8 ± 1.5 50.7 ± 1.4 49.1 ± 4.5 47.1 ± 1.8 50.8 ± 3.7 50.7 ± 2.3
Crude fat (%) 41.8 ± 1.8 42.4 ± 1.7 42.3 ± 0.6 42.0 ± 3.6 44.5 ± 2.2 42.7 ± 2.9 41.5 ± 0.8
Ash (%) 5.7 ± 0.9 6.5 ± 0.8 6.2 ± 1.2 5.7 ± 0.5 5.6 ± 1.1 5.8 ± 0.2 6.3 ± 0.4
Calcium (%) 1.1 ± 0.2 1.2 ± 0.1 1.2 ± 0.3 1.2 ± 0.3 1.0 ± 0.3 1.2 ± 0.3 1.2 ± 0.2
Potassium (%) 1.0 ± 0.0 1.0 ± 0.1 1.0 ± 0.0 1.0 ± 0.0 1.0 ± 0.0 1.0 ± 0.0 1.0 ± 0.0
Magnesium (%) 0.1 ± 0.0 0.1 ± 0.0 0.1 ± 0.0 0.1 ± 0.0 0.1 ± 0.0 0.1 ± 0.0 0.1 ± 0.0
Phosphorus (%) 1.1 ± 0.1 1.1 ± 0.0 1.2 ± 0.1 1.1 ± 0.2 1.0 ± 0.1 1.1 ± 0.0 1.2 ± 0.1
Sodium (%) 0.2 ± 0.0 0.3 ± 0.0 0.3 ± 0.0 0.3 ± 0.0 0.3 ± 0.0 0.2 ± 0.0 0.3 ± 0.0
Copper (ppm) ND ND ND ND ND ND ND
Manganese (ppm) ND ND ND ND ND ND ND
Zinc (ppm) 38.2 ± 3.1 36.5 ± 2.5 39.6 ± 4.3 38.3 ± 4.5 34.7 ± 4.4 32.7 ± 1.4 36.8 ± 2.5
abcMeans within rows with different superscripts are significantly different (P < 0.05).
ND = Not detected.
S.A. Collins et al. Aquaculture 483 (2018) 27–37
35
All processing methods decreased the glucosinolate concentration of
the HORM. The glucosinolate level of the HORM diet was below the
safe upper limit for rainbow trout in this case, but this information may
be important when formulating rainbow trout diets containing levels of
HORM exceeding 80 g/kg. Enzyme treatment did not influence growth
performance or the expression of transcripts associated with intestinal
inflammation in fish. However, the HP-SZ product had an interestingly
positive effect on intestinal histology. It would be interesting in the
future to feed the same enzyme treatments to rainbow trout at higher
dietary inclusion levels to determine which, if any, levels would cause
inflammation in the fish, as assessed by histology and distal intestine
gene expression.
Acknowledgements
This project was funded by Genome Atlantic, The Atlantic Canada
Opportunities Agency - Atlantic Innovation Fund (ACOA AIF: 195298)
and the Province of Nova Scotia Aquaculture Development Fund (Nova
Scotia Department of Aquaculture and Fisheries, Aquaculture
Development Fund Project #32). We are grateful to Alan Donkin and
Northeast Nutrition Inc. for donating feed ingredients used in this ex-
periment, as well as to Rob Patterson and Canadian Biosystems Inc. for
donating the enzymes used in this trial. Thank you to Chenxin Han,
Gillian Tobin-Huxley, Scott Jeffrey, Paul MacIsaac, Cara Kirkpatrick,
Margie Hartling, Janice MacIsaac, Jamie Fraser, Michael McConkey,
Fig. 2. qPCR analyses of transcripts associated with gut in-
flammation in fish: GILTa (A); GILTb (B); PAR2a (C); PAR2b
(D) IL1ß3; (E); MyD88 (F); TGFß1a (G); TGFß1b (H). Gene
expression data are presented as mean (± standard error)
relative quantity (RQ) values (i.e. values for the transcript of
interest were normalized to both elongation factor 1-alpha and
β-actin transcript levels, and were calibrated to the individual
with the lowest normalized expression of that given gene). HP-
SZ HORM, High-Pectinase Superzyme HORM; R-HORM,
Rhizopus HORM. There were no significant differences in
transcript levels between diets. In all cases, n = 9; P < 0.05
was considered to be statistically significant.
S.A. Collins et al. Aquaculture 483 (2018) 27–37
36
Dr. Christopher Parrish and Dr. Stefanie Columbo for their assistance.
Thank you to Dr. Isobel Parkin and Rob Wood at the Saskatoon
Research Centre (Agriculture and Agri-Food Canada, Saskatoon, SK,
Canada) for conducting the glucosinolate analysis, Dr. Bogdan
Slominski and Dr. Anna Rogiewicz at the University of Manitoba
for
performing the NSP analysis and Dr. Thomas P. Mawhinney and as-
sociates at the University of Missouri – Columbia for determining the
amino acid composition of the samples.
References
AOAC (Association of Official Analytical Chemists), 2003. Official Methods of Analysis,
17th Edition. AOAC, Gaithersburg, MD, USA.
AOAC (Association of Official Analytical Chemists), 2005. Official Methods of Analysis,
18th Edition. AOAC, Gaithersburg, MD, USA.
AOAC (Association of Official Analytical Chemists), 2006. Official Methods of Analysis,
18th Edition. AOAC, Gaithersburg, MD, USA.
Brown, T.D., Hori, T.S., Xue, X., Ye, C.L., Anderson, D.M., Rise, M.L., 2016. Functional
genomic analysis of the impact of camelina (Camelina sativa) meal on Atlantic salmon
(Salmo salar) distal intestine gene expression and physiology. Mar. Biotechnol. 18,
418–435.
Bullerwell, C.N., Collins, S.A., Lall, S.P., Anderson, D.M., 2016. Growth performance,
proximate and histological analysis of rainbow trout fed diets containing Camelina
sativa seeds, meal (high-oil and solvent-extracted) and oil. Aquaculture 452,
342–350.
Burel, C., Boujard, T., Escaffre, A.M., Kaushik, S.J., Boeuf, G., Mol, K.A., Van der Geyten,
S., Kuhn, E.R., 2000. Dietary low-glucosinolate rapeseed meal affects thyroid status
and nutrient utilization in rainbow trout (Oncorhynchus mykiss). Br. J. Nutr. 83,
653–664.
Caballero-Solares, A., Hall, J.R., Xue, X., Eslamloo, K., Taylor, R.G., Parrish, C.C., Rise,
M.L., 2017. The dietary replacement of marine ingredients by terrestrial animal and
plant alternatives modulates the antiviral immune response of Atlantic salmon (Salmo
salar). Fish Shellfish Immunol. 64, 24–38.
Canadian Council on Animal Care (CCAC), 2005. Guide to the Care and Use of Fish in
Research Teaching and Testing. Canadian Council on Animal Care, Ottawa, ON,
Canada.
Castillo, S., Gatlin, D.M., 2015. Dietary supplementation of exogenous carbohydrase
enzymes in fish nutrition: a review. Aquaculture 435, 286–292.
Daun, J.K., McGregor, D.I., 1981. Glucosinolate analysis of rapeseed (canola). In: Method
of the Canadian Grain Commission Grain Research Laboratory (Revised 1983).
Canadian Grain Commission, Winnipeg, MB, Canada.
Drury, A.A., Wallington, E.A., 1980. Carleton's Histological Technique, 5th Ed. Oxford
University Press, New York, USA.
Egounlety, M., Aworh, O.C., 2003. Effect of soaking, dehulling, cooking and fermentation
with Rhizopus oligosporus on the oligosaccharides, trypsin inhibitor, phytic acid and
tannins of soybean (Glycine max Merr.), cowpea (Vigna unguiculata L. Walp) and
groundbean (Macrotyloma geocarpa Harms). J. Food Eng. 56, 249–254.
Francis, G., Makkar, H.P., Becker, K., 2001. Antinutritional factors present in plant-de-
rived alternate fish feed ingredients and their effects in fish. Aquaculture 199,
197–227.
Glencross, B.D., Carter, C.G., Duijster, N., Evans, D.R., Dods, K., McCafferty, P., Hawkins,
W.E., Maas, R., Sipsas, S., 2004. A comparison of the digestibility of a range of lupin
and soybean protein products when fed to either Atlantic salmon (Salmo salar) or
rainbow trout (Oncorhynchus mykiss). Aquaculture 237, 333–346.
Hartanti, A.T., Rahayu, G., Hidayat, I., 2015. Rhizopus species from fresh tempeh col-
lected from several regions in Indonesia. HAYATI J. Biosci. 22, 136–142.
Hixson, S.M., Parrish, C.C., Anderson, D.M., 2014. Full substitution of fish oil with ca-
melina (Camelina sativa) oil, with partial substitution of fish meal with camelina
meal, in diets for farmed Atlantic salmon (Salmo salar) and its effect on tissue lipids
and sensory quality. Food Chem. 157, 51–61.
Hixson, S.M., Parrish, C.C., Wells, J.S., Winkowski, E.M., Anderson, D.M., Bullerwell,
C.N., 2015. Inclusion of camelina meal as a protein source in diets for farmed
salmonids. Aquac. Nutr. 22, 615–630.
Hossain, M.A., Jauncy, K., 1993. The effects of varying dietary phytic acid, calcium and
magnesium levels on the nutrition of common carp, Cyprinus carpio. In: Kaushik, S.J.,
Luquet, P. (Eds.), Fish Nutrition in Practice, Biarritz (France), June 24–27, 1991,
Paris 1993, L Colloques No. 61, pp. 705–715.
Lange, R., Schumann, W., 1995. Glucosinolate in Leindottersamen. Fat Sci. Technol. 97,
146–152.
Lilleng, E., Penn, M.H., Øyvind, H., Xu, C., Bakke, A.M., Krogdahl, Å., Landsverk, T.,
Frøystad-Sugen, M.K., 2009. Decreased expression of TGF-ß, GILT and T-cell markers
in the early stages of soybean enteropathy in Atlantic salmon (Salmo salar L.). Fish
Shellfish Immunol. 27, 65–72.
Maehr, T., Costa, M.M., González Vecino, J.L., Wadsworth, S., Martin, S.A.M., Wang, T.,
Secombes, C.J., 2013. Transforming growth factor-ß1b: A second TGF-ß1 paralogue
in the rainbow trout (Oncorhynchus mykiss) that has a lower constitutive expression
but is more responsive to immune stimulation. Fish Shellfish Immunol. 34, 420–432.
Mansfield, G.S., Desai, A.R., Nilson, S.A., Van Kessel, A.G., Drew, M.D., Hill, J.E., 2010.
Characterization of rainbow trout (Oncorhynchus mykiss) intestinal microbiota and
inflammatory marker gene expression in a recirculating aquaculture system.
Aquaculture 307, 95–104.
Marjara, I.S., Chikwati, E.M., Valen, E.C., Krogdahl, Å., Bakke, A.M., 2012.
Transcriptional regulation of IL-17A and other inflammatory markers during the
development of soybean meal-induced enteropathy in the distal intestine of Atlantic
salmon (Salmo salar L.). Cytokine 60, 186–196.
Matthäus, B., Zubr, J., 2000. Variability of specific components in Camelina sativa oilseed
cakes. Ind. Crop. Prod. 12, 9–18.
NRC (National Research Council), 2011. Nutrient Requirements of Fish and Shrimp.
National Academies Press, Washington, D.C (pp: 70, 236-237, 327-347).
Ortega-David, E., Rodriguez-Stouvenel, A., 2014. Bioprocessing of lupin cotyledons
(Lupinus mutabilis) with Rhizopus oligosporus for reduction of quinolizidine alkaloids.
J. Food. Process. Technol. 5, 2.
Pfaffl, M.W., 2001. A new mathematical model for relative quantification in real-time RT-
PCR. Nucleic Acids Res. 29, e45.
Refstie, S., Korsøen, Ø.J., Storebakken, T., Baeverfjord, G., Lein, I., Roem, A.J., 2000.
Differing nutritional responses to dietary soybean meal in rainbow trout
(Oncorhynchus mykiss) and Atlantic salmon (Salmo salar). Aquaculture 190, 49–63.
Russo, R., Reggiani, R., 2012. Antinutritive compounds in twelve Camelina sativa geno-
types. Am. J. Plant Sci. 3, 1408–1412.
Schuster, A., Friedt, W., 1998. Glucosinolate content and composition as parameters of
quality of Camelina seed. Ind. Crop. Prod. 7, 297–302.
Sinha, A.k., Kumar, V., Makkar, H.P.S., De Boeck, G., Becker, K., 2011. Non-starch
polysaccharides and their role in fish nutrition – a review. Food Chem. 127,
1409–1426.
Slominski, B.A., Jia, W., Rogiewicz, A., Nyachoti, C.M., Hickling, D., 2012. Low-fiber
canola. Part 1. Chemical and nutritive composition of the meal. J. Agric. Food Chem.
60, 12225–12230.
Song, L., Thornalley, P.J., 2007. Effect of storage, processing and cooking on glucosino-
late content of Brassica vegetables. Food Chem. Toxicol. 45, 216–224.
Vandesompele, J., De Preter, K., Pattyn, F., Poppe, B., Van Roy, N., De Paepe, A.,
Speleman, F., 2002. Accurate normalization of real-time quantitative RT-PCR data by
geometric averaging of multiple internal control genes. Genome Biol. 3, 1–12.
Xue, X., Hixson, S.M., Hori, T.S., Booman, M., Parrish, C.C., Anderson, D.M., Rise, M.L.,
2015. Atlantic salmon (Salmo salar) liver transcriptome response to diets containing
Camelina sativa products. Comp. Biochem. Physiol. Part D Genomics Proteomics 14,
1–15.
Ye, C.L., 2014. Evaluation of Camelina (Camelina sativa) Byproducts Fed to Atlantic
salmon (Salmo salar) in Practical Diets (M.Sc. Thesis). Dalhousie University, Truro,
NS, Canada.
Ye, C., Anderson, D.M., Lall, S.P., 2016. The effects of camelina oil and solvent extracted
camelina meal on the growth, carcass composition and hindgut histology of Atlantic
salmon (Salmo salar) parr in freshwater. Aquaculture 450, 397–404.
Zubr, J., 1997. Oil-seed crop: Camelina
sativa. Ind. Crop. Prod. 6, 113–119.
Zubr, J., 2003. Dietary fatty acids and amino acids of Camelina sativa seed. J. Food Qual.
26, 451–462.
Zubr, J., 2010. Carbohydrates, vitamins and minerals of Camelina sativa seed. Nutr. Food
Sci. 40, 523–531.
S.A. Collins et al. Aquaculture 483 (2018) 27–37
37
http://refhub.elsevier.com/S0044-8486(17)31829-X/rf0005
http://refhub.elsevier.com/S0044-8486(17)31829-X/rf0005
http://refhub.elsevier.com/S0044-8486(17)31829-X/rf0010
http://refhub.elsevier.com/S0044-8486(17)31829-X/rf0010
http://refhub.elsevier.com/S0044-8486(17)31829-X/rf0015
http://refhub.elsevier.com/S0044-8486(17)31829-X/rf0015
http://refhub.elsevier.com/S0044-8486(17)31829-X/rf0020
http://refhub.elsevier.com/S0044-8486(17)31829-X/rf0020
http://refhub.elsevier.com/S0044-8486(17)31829-X/rf0020
http://refhub.elsevier.com/S0044-8486(17)31829-X/rf0020
http://refhub.elsevier.com/S0044-8486(17)31829-X/rf0025
http://refhub.elsevier.com/S0044-8486(17)31829-X/rf0025
http://refhub.elsevier.com/S0044-8486(17)31829-X/rf0025
http://refhub.elsevier.com/S0044-8486(17)31829-X/rf0025
http://refhub.elsevier.com/S0044-8486(17)31829-X/rf0030
http://refhub.elsevier.com/S0044-8486(17)31829-X/rf0030
http://refhub.elsevier.com/S0044-8486(17)31829-X/rf0030
http://refhub.elsevier.com/S0044-8486(17)31829-X/rf0030
http://refhub.elsevier.com/S0044-8486(17)31829-X/rf0035
http://refhub.elsevier.com/S0044-8486(17)31829-X/rf0035
http://refhub.elsevier.com/S0044-8486(17)31829-X/rf0035
http://refhub.elsevier.com/S0044-8486(17)31829-X/rf0035
http://refhub.elsevier.com/S0044-8486(17)31829-X/rf0040
http://refhub.elsevier.com/S0044-8486(17)31829-X/rf0040
http://refhub.elsevier.com/S0044-8486(17)31829-X/rf0040
http://refhub.elsevier.com/S0044-8486(17)31829-X/rf0045
http://refhub.elsevier.com/S0044-8486(17)31829-X/rf0045
http://refhub.elsevier.com/S0044-8486(17)31829-X/rf0050
http://refhub.elsevier.com/S0044-8486(17)31829-X/rf0050
http://refhub.elsevier.com/S0044-8486(17)31829-X/rf0050
http://refhub.elsevier.com/S0044-8486(17)31829-X/rf0055
http://refhub.elsevier.com/S0044-8486(17)31829-X/rf0055
http://refhub.elsevier.com/S0044-8486(17)31829-X/rf0060
http://refhub.elsevier.com/S0044-8486(17)31829-X/rf0060
http://refhub.elsevier.com/S0044-8486(17)31829-X/rf0060
http://refhub.elsevier.com/S0044-8486(17)31829-X/rf0060
http://refhub.elsevier.com/S0044-8486(17)31829-X/rf0065
http://refhub.elsevier.com/S0044-8486(17)31829-X/rf0065
http://refhub.elsevier.com/S0044-8486(17)31829-X/rf0065
http://refhub.elsevier.com/S0044-8486(17)31829-X/rf0070
http://refhub.elsevier.com/S0044-8486(17)31829-X/rf0070
http://refhub.elsevier.com/S0044-8486(17)31829-X/rf0070
http://refhub.elsevier.com/S0044-8486(17)31829-X/rf0070
http://refhub.elsevier.com/S0044-8486(17)31829-X/rf0075
http://refhub.elsevier.com/S0044-8486(17)31829-X/rf0075
http://refhub.elsevier.com/S0044-8486(17)31829-X/rf0080
http://refhub.elsevier.com/S0044-8486(17)31829-X/rf0080
http://refhub.elsevier.com/S0044-8486(17)31829-X/rf0080
http://refhub.elsevier.com/S0044-8486(17)31829-X/rf0080
http://refhub.elsevier.com/S0044-8486(17)31829-X/rf0085
http://refhub.elsevier.com/S0044-8486(17)31829-X/rf0085
http://refhub.elsevier.com/S0044-8486(17)31829-X/rf0085
http://refhub.elsevier.com/S0044-8486(17)31829-X/rf0090
http://refhub.elsevier.com/S0044-8486(17)31829-X/rf0090
http://refhub.elsevier.com/S0044-8486(17)31829-X/rf0090
http://refhub.elsevier.com/S0044-8486(17)31829-X/rf0090
http://refhub.elsevier.com/S0044-8486(17)31829-X/rf0095
http://refhub.elsevier.com/S0044-8486(17)31829-X/rf0095
http://refhub.elsevier.com/S0044-8486(17)31829-X/rf0100
http://refhub.elsevier.com/S0044-8486(17)31829-X/rf0100
http://refhub.elsevier.com/S0044-8486(17)31829-X/rf0100
http://refhub.elsevier.com/S0044-8486(17)31829-X/rf0100
http://refhub.elsevier.com/S0044-8486(17)31829-X/rf0105
http://refhub.elsevier.com/S0044-8486(17)31829-X/rf0105
http://refhub.elsevier.com/S0044-8486(17)31829-X/rf0105
http://refhub.elsevier.com/S0044-8486(17)31829-X/rf0105
http://refhub.elsevier.com/S0044-8486(17)31829-X/rf0110
http://refhub.elsevier.com/S0044-8486(17)31829-X/rf0110
http://refhub.elsevier.com/S0044-8486(17)31829-X/rf0110
http://refhub.elsevier.com/S0044-8486(17)31829-X/rf0110
http://refhub.elsevier.com/S0044-8486(17)31829-X/rf0115
http://refhub.elsevier.com/S0044-8486(17)31829-X/rf0115
http://refhub.elsevier.com/S0044-8486(17)31829-X/rf0115
http://refhub.elsevier.com/S0044-8486(17)31829-X/rf0115
http://refhub.elsevier.com/S0044-8486(17)31829-X/rf0120
http://refhub.elsevier.com/S0044-8486(17)31829-X/rf0120
http://refhub.elsevier.com/S0044-8486(17)31829-X/rf0125
http://refhub.elsevier.com/S0044-8486(17)31829-X/rf0125
http://refhub.elsevier.com/S0044-8486(17)31829-X/rf0130
http://refhub.elsevier.com/S0044-8486(17)31829-X/rf0130
http://refhub.elsevier.com/S0044-8486(17)31829-X/rf0130
http://refhub.elsevier.com/S0044-8486(17)31829-X/rf0135
http://refhub.elsevier.com/S0044-8486(17)31829-X/rf0135
http://refhub.elsevier.com/S0044-8486(17)31829-X/rf0140
http://refhub.elsevier.com/S0044-8486(17)31829-X/rf0140
http://refhub.elsevier.com/S0044-8486(17)31829-X/rf0140
http://refhub.elsevier.com/S0044-8486(17)31829-X/rf0145
http://refhub.elsevier.com/S0044-8486(17)31829-X/rf0145
http://refhub.elsevier.com/S0044-8486(17)31829-X/rf0150
http://refhub.elsevier.com/S0044-8486(17)31829-X/rf0150
http://refhub.elsevier.com/S0044-8486(17)31829-X/rf0155
http://refhub.elsevier.com/S0044-8486(17)31829-X/rf0155
http://refhub.elsevier.com/S0044-8486(17)31829-X/rf0155
http://refhub.elsevier.com/S0044-8486(17)31829-X/rf0160
http://refhub.elsevier.com/S0044-8486(17)31829-X/rf0160
http://refhub.elsevier.com/S0044-8486(17)31829-X/rf0160
http://refhub.elsevier.com/S0044-8486(17)31829-X/rf0165
http://refhub.elsevier.com/S0044-8486(17)31829-X/rf0165
http://refhub.elsevier.com/S0044-8486(17)31829-X/rf0170
http://refhub.elsevier.com/S0044-8486(17)31829-X/rf0170
http://refhub.elsevier.com/S0044-8486(17)31829-X/rf0170
http://refhub.elsevier.com/S0044-8486(17)31829-X/rf0175
http://refhub.elsevier.com/S0044-8486(17)31829-X/rf0175
http://refhub.elsevier.com/S0044-8486(17)31829-X/rf0175
http://refhub.elsevier.com/S0044-8486(17)31829-X/rf0175
http://refhub.elsevier.com/S0044-8486(17)31829-X/rf0180
http://refhub.elsevier.com/S0044-8486(17)31829-X/rf0180
http://refhub.elsevier.com/S0044-8486(17)31829-X/rf0180
http://refhub.elsevier.com/S0044-8486(17)31829-X/rf0185
http://refhub.elsevier.com/S0044-8486(17)31829-X/rf0185
http://refhub.elsevier.com/S0044-8486(17)31829-X/rf0185
http://refhub.elsevier.com/S0044-8486(17)31829-X/rf0190
http://refhub.elsevier.com/S0044-8486(17)31829-X/rf0195
http://refhub.elsevier.com/S0044-8486(17)31829-X/rf0195
http://refhub.elsevier.com/S0044-8486(17)31829-X/rf0200
http://refhub.elsevier.com/S0044-8486(17)31829-X/rf0200
	Evaluation of enzyme- and Rhizopus oligosporus-treated high oil residue camelina meal on rainbow trout growth performance and distal intestine histology and inflammatory biomarker gene expression
	Introduction
	Materials and methods
	Experimental ingredients
	Diet preparation
	Fish husbandry
	Growth response and related factors
	Tissue sampling
	Chemical analysis
	Histology
	RNA preparation
	Real-time quantitative polymerase chain reaction (qPCR)
	Statistical analysis
	Results
	Discussion
	Conclusion
	Acknowledgements
	References