Artigo 1

Prévia do material em texto

J Cell Biochem. 2020;1–10. wileyonlinelibrary.com/journal/jcb © 2020 Wiley Periodicals, Inc. | 1
Received: 10 September 2019 | Accepted: 30 January 2020
DOI: 10.1002/jcb.29693
RE S EARCH ART I C L E
IRX5prompts genomic instability in colorectal cancer cells
Xun Sun1 | Xinying Jiang2 | Jianzhong Wu1 | Rong Ma1 | Yiqi Wu2 |
Haixia Cao1 | Zhuo Wang1 | Siwen Liu1 | Junying Zhang1 | Yang Wu1 |
Yuan Zhang1 | Jifeng Feng1 | Ting Wang2
1The Affiliated Cancer Hospital of Nanjing Medical University, Jiangsu Cancer Hospital, Jiangsu Institute of Cancer Research, Nanjing,
Jiangsu, China
2Department of Cell Biology, Nanjing Medical University, Nanjing, Jiangsu, China
Correspondence
Jifeng Feng, The Affiliated Cancer
Hospital of Nanjing Medical University,
Jiangsu Cancer Hospital, Jiangsu Institute
of Cancer Research, Nanjing, Jiangsu
210009, China.
Email: jifeng_feng@163.com
Ting Wang, Department of Cell Biology,
Nanjing Medical University, Nanjing,
Jiangsu 211166, China.
Email: wangting@njmu.edu.cn
Funding information
National Natural Science Foundation of
China, Grant/Award Number: 21577066;
Jiangsu Provincial Key Research
Development Program,
Grant/Award Number: BE2016795;
Jiangsu Provincial Key Medical Discipline
(Laboratory)
Abstract
The Iroquois homeobox gene 5 (IRX5), one of the members of the Iroquois
homeobox family, has been identified to correlate with worse prognosis in many
cancers, including colorectal cancer (CRC). In this study, upregulation of IRX5
revealed a great reduction in the proliferation of CRC cell line SW480 and DLD‐1,
which was accompanied by G1/S arrest, increased expression in cyclin E1, P21, and
P53 and a decrease in cyclin A2, B1, and D1. Furthermore, IRX5‐mediated an
increase expression of RH2A protein, the biomarker of DNA damage.
Consequently, the SA‐β‐gal level is higher in IRX5‐overexpression cells compared to
control ones, which showed elevated DNA damage triggered cellular senescence.
Recapitulating the above findings, IRX5 exhibited higher levels of genomic
instability. IRX5 may be a perspective target for cancer therapy and it deserves
further investigation.
KEYWORD S
colorectal cancer, genomic instability, Iroquois homeobox genes, IRX5, RH2A pathway
1 | INTRODUCTION
Nowadays, in both sexes combined, the incidence of
colorectal cancer (CRC) is ranked third among all kinds
of cancer. Despite advanced surgical techniques, the
mortality is still in the second place following lung cancer
according to global cancer statistics 2018.1 Therefore, it is
urgent to identify original biomarkers for prognosis and
valid therapeutic targets for individuals. Microsatellite
instability (MSI), chromosomal instability (CIN), and
CpG island methylator phenotype (CIMP) are three ways
leading to genomic instability of CRC. WNT pathway,
MAPK and PI3K pathways, TGF‐β pathway and TP53
involving in CRC are the molecular basis of genomic
aberrations.2 TALE (3‐amino acid loop extension) super‐
class of atypical homeodomain proteins is the common
feature of Iroquois gene family.3 The transcription
factors encoded by the Iroquois gene is a conserved
Abbreviations: CDK, cyclin‐dependent kinase; CIN, chromosomal instability; CRC, colorectal cancer; DDR, DNA damage response; DLD‐1‐Control,
stably transfected with control vector; DLD‐1‐IRX5, stable IRX5‐overexpressing DLD‐1; DSBs, DNA double‐strand breaks; HCC, hepatocellular
carcinoma; IRX, Iroquois homeobox; OPN, osteopontin; SW480‐Control, stably transfected with control vector; SW480‐IRX5, stable
IRX5‐overexpressing SW480.
http://orcid.org/0000-0002-9654-9473
mailto:jifeng_feng@163.com
mailto:wangting@njmu.edu.cn
http://crossmark.crossref.org/dialog/?doi=10.1002%2Fjcb.29693&domain=pdf&date_stamp=2020-03-11
DNA‐binding motif with a length of 60 amino acids
called the homeodomain.3 In mammals, we divided six
genes of the Iroquois into two homologous clusters, IRXA
(IRX1, IRX4, and IRX5) and IRXB (IRX2, IRX3, and
IRX6) which had the position on chromosome 8 and
chromosome 16, respectively.4 In previous research,
Iroquois proteins have a vital function in early embryonic
patterning, cell‐type specification as well as tumorigen-
esis, either as activators or repressors.5 Recent data also
suggest that Iroquois proteins have an influence in reg-
ulating apoptosis, angiogenesis, and/or metastasis.6
Downregulation of tumor‐suppressive gene IRX1 in
gastric cancer inhibited peritoneal spread and metastasis.7,8
IRX4, downregulated in prostate cancer, suppressed cells
growth.9 IRX2 was elevated in primary human osteosarcoma
and had a significant relationship with tumor progression
and individual prognosis.10,11 IRX3, upregulated in hepato-
cellular carcinoma, prompted proliferation, migration, and
invasion of SMMC7721 cells.12 The expression of IRX5 is
detected in several developing tissues and a large number of
cancers including lung cancer,13 prostate cancer,4 tongue
squamous cell carcinoma,5 hepatocellular carcinomas,14 and
CRC. Evidence that IRX5 has an effect in regulating pro-
liferation, migration, invasion, apoptosis, and/or metastasis is
accumulating. In lung cancer, tumor growth was inhibited
through IRX5 loss.15 In prostate cancer, IRX5 silencing
prompted cell apoptosis.4 Depletion of IRX5 in tongue
squamous significantly upregulated OPN expression and gi-
ven a growth advantage of tumor cells.5 In hepatocellular
carcinoma, IRX5 increased the tumorigenicity of HCC
cells.14 In particular, the high expression of IRX5 in CRC and
human adenocarcinoma is noticed. IRX5 could reduce the
sensitivity to the cytostatic effect of TGF‐β which is the core
component of the TGF‐β pathway,6 accelerating the rate of
tumor growth in CRC.
IRX5‐regulated p53 and p21 which were corn com-
ponents of controlling cell cycle and apoptosis in human
prostate cancer cells.4 Along similar lines mediating cell
cycle arrest, p21 downstream of p53 plays an essential
role in maintaining genomic stability. Here we identify
that IRX5 may promote genomic instability by inducing
DNA damage on an ATM‐dependent way.
The proliferation of cells is to precisely replicate its ge-
netic material and then transfer to daughter cells.16 When a
mistake happens during the process genomic instability will
ensue continuously. Two major mechanisms can be acti-
vated to make sure of the fidelity of DNA replication. Cyclin‐
dependent kinase (CDK)‐dependent mechanisms and CDK‐
independent mechanisms are considered as the first class.
The second class includes checkpoints dependent on DNA
damage and coordinating DNA damage repair mechanisms.
Senescence and cell cycle arrest are consist of the DNA‐
damage dependent checkpoints mechanism.17 In breast
cancer, the genomic instability caused by BRCA1 deficiency
triggered G2/M arrest.18 In human oral carcinoma G0/G1
cell cycle arrest caused by Umbelliferone‐inducing genomic
integrity.19 In our research, G1/S cell cycle arrest was found
in IRX5‐overexpression cells. The differencing phase of cell
cycle arrest may due to different cancer and target genes.
Here we identify IRX5 may promote genomic instability by
inducing DNA damage on ATM‐dependent way.
2 | MATERIALS AND METHODS
2.1 | Cells
SW480 and DLD‐1 were cultured every 72 hours in
Dulbecco's modified Eagle's medium (DMEM) basic (1×)
(Thermo Fisher Scientific Inc., Waltham, MA) with 10% fetal
bovine serum and 4/3 and 2/3 µg/mL Puromycin (Hanbio
Biotechnology, Shanghai, China) at 37°C under 5% CO2.
2.2 | Western blot analysis
Phosphate‐buffered saline (PBS) was used to wash cells three
times and then cells were lysed in 200 µL ice‐cold radio-
immunoprecipitation assay lysis (Thermo Fisher Scientific
Inc) and 2 µL phenylmethylsulfonyl fluoride. We use one
drop machine to perform a protein quantification assay.
Determine the protein concentration for each cell lysate. Add
50 µL LDS Sample Buffer (4×) (Thermo Fisher Scientific Inc)
and 20 µL Sample Reducing Agent (10×) (Thermo Fisher
Scientific Inc) to 165 µL cell lysate. To denature samples, boil
each cell lysate in samplebuffer at 100°C for 10minutes.
Protein samples and markers were resolved on a 10%
NuPAGE precast gel (Invitrogen Corp, Carlsbad, CA),
transferred to a polyvinylidene fluoride membrane and
blotted with anti‐cyclin A2 (1:10 000, ab181591, Abcam, UK),
anti‐cyclin B1 (1:25 000; ab32053; Abcam), anti‐cyclin D1
(1:10 000; ab16663; Abcam), anti‐cyclin E1 (1:2000;
ab133266; Abcam), anti‐GAPDH (1:10 000; ab181602;
Abcam) and anti‐RH2A (1:2000; ab81299; Abcam). Anti‐p21
(1:2000; 2947T) was from Cell Signaling Technology. Anti‐
p53 (1:2000; BS1564) was from Bioword Technology.
Secondary anti‐rabbit IgG, HRP‐linked Antibody (1:5000;
7074p2) was from Cell Signaling Technology. The signal was
detected using the BeyoECL Plus from Beyotime Technology
(Shanghai, China).
2.3 | Cell counting kit 8
Prepare cells in a 96‐well plate (100 µL/well) and add
10 µL of cell counting kit 8 (CCK8) solution to each well.
2 | SUN ET AL.
Then incubate at 37°C for 1 to 4 hours. Measure absor-
bance at OD= 450 nm.
2.4 | RNA extraction and quantitative
real‐time polymerase chain reaction
Use Trizol to extract RNA and synthesis cDNA with RT
master mix (Takara, Kusatsu city, Shiga, Japan). Real‐
time polymerase chain reaction (PCR) was performed
using PowerUp SYBR Green Master Mix (Thermo Fisher
Scientific, Carlsbad, CA) in an ABI 7300 Real‐time PCR
System (ABI Torrance, CA).
CyclinA2:5′‐CGCTCCAAGAGGACCAGGA‐3′/5′‐GG
TCCGCGGTTGTTGGAC‐3′;CyclinB1:5′‐TTCGCCTGAG
CCTATTTTGGTA‐3′/5′‐AGCTCCATCTTCTGCATCCA
CAT‐3′;CyclinD1:5′‐GTCCTACTACCGCCTCACACG‐3′/
5′‐GGGCTTCGATCTGCTCCTG‐3′;CyclinE1:5′‐TTCTTG
AGCAACACCCTCTTCTGCAGCC‐3′/5′‐TCGCCATATA
CCGGTCAAAGAAATCTTGTGCC‐3′;P21:5′‐CCTGTCA
CTGTCTTGTACCCTTGT‐3′/5′‐GCCGTTTTCGACCCTG
AGA‐3′;RH2A:5′‐GGCCTCCAGTTCCCAGTG‐3′/5′‐TCA
GCGGTGAGGTACTCCAG‐3′;P53:5′‐CCCCTCCTGGCC
CCTGTCATCTT‐3′/5′‐GCCTCACAACCTCCGTCATGT
GC‐3′;IRX5:5′‐ACCCAGCGTACCGGAAGAA‐3′/5′‐CGG
CGTCCACGTCATTTTAT‐3′;ATM:5′‐GCTTATGACGTT
GCATGAAACG‐3′/5′‐GTGACGGGAAATATGGTGGAT
T‐3′, GAPDH:5′‐GACTCATGACCACAGTCCATGC‐3′/
5′‐AGAGGCAGGGATGATGTTCTG‐3′
2.5 | Immunofluorescence
Four percent paraformaldehyde was added for 15 min-
utes to fix cells at room temperature. Triton X‐100 (0.5%)
in PBS and 5% bovine serum albumin was added to
permeabilize and block cells for 15 and 30minutes, re-
spectively. Cells were incubated with Anti‐RH2A (1:500;
ab81299; Abcam) and anti‐ATM (1:500; ab81292; Abcam)
in 4°C overnight and with Alexa Fluor‐conjugated sec-
ondary antibodies (1:500; ab150077; Abcam) for 1 hour at
room temperature. 4′,6‐Diamidino‐2‐phenylindole (Be-
yotime Technology) was added for 3 minutes. Images
were captured using Axio scope A1.
2.6 | Senescence‐associated
b‐galactosidase assay
Senescence‐associated β‐galactosidase (SA‐β‐gal)
assay was based on the manufacturer's instructions
(Beyotime Technology). Briefly, use PBS to wash cells
twice, add fixation buffer for 15 minutes at room
temperature, and incubate β‐galactosidase detection
solution with cells overnight at 37°C.
3 | RESULT
3.1 | IRX5 overexpression reduce the
number of colorectal cancer cells
We overexpressed exogenous IRX5 and empty vector
in both cells stably to uncover whether IRX5 is
involved in DLD‐1 cells and SW480 cells progression.
aRT‐PCR and Western blot analysis needed to quan-
titate IRX5 expression. IRX5 mRNA was enhanced
about 17‐ and 25‐fold, respectively, and IRX5 protein
levels were rose nearly threefold in DLD‐1 and SW480
cells overexpression cells compared to control cells
(Figure 1A). We found the difference of growth rate
between IRX5‐overexpression and control ones when
cells were being cultured. To analysis the difference
precisely we did the CCK8 assay. The CCK8 assay
showed that IRX5 overexpression markedly reduced
DLD‐1 and SW480 cell numbers at 96 hours compared
with controls (Figure 1B). Therefore, CRC cell growth
was inhibited by IRX5.
3.2 | IRX5 induces cell cycle arrest
IRX5 overexpression reduced cell growth implies that
cells may withdraw from the cell cycle. When DNA
double‐strand breaks (DSBs) took place, cell cycle
checkpoints could be activated to maintain the
genomic stability of proliferating cells. We hypothe-
sized that IRX5 had a direct effect on cell cycle
regulation. Then we analyzed cells by not only flow
cytometry but also Western blot analysis. We found
that IRX5 triggered G1 arrest of the cell cycle in
IRX5‐overexpression cells compared with the con-
trols, confirming that IRX5 overexpression does in-
deed drives cell cycle arrest (Figure 1C). Furthermore,
IRX5 affected cell cycle progression by decreasing
levels of cyclin A2, B1, and D1 and increasing cyclin
E1, P21, and P53 protein levels (Figure 2A,B). To
elucidate more clearly whether DNA damage
accumulation triggered cell cycle arrest as a response
to stress, the presence of RH2A, the biomarker of
DNA damage, was monitored. As we expected,
RH2A accumulated in IRX5‐overexpression cells
(Figure 2A,B). The same result arose in immuno-
fluorescence of RH2A (Figure 2C). Taken together,
IRX5 overexpression induces cell cycle arrest includ-
ing RH2A accumulation.
SUN ET AL. | 3
3.3 | IRX5 provokes cellular senescence
in colorectal cancer cells
The accumulation of DNA damage persistently activated
cell cycle checkpoints to mediate DNA repair pathway or
DNA damage response. Apoptosis and senescence were
two major mechanisms of DNA damage response. And
we further tested cellular senescence. The feature of cells
in senescence condition was flattened cell shape, higher
nuclear area and cell cycle exit. Notably, senescence was
FIGURE 1 IRX5 overexpression reduces the number of colorectal cancer cells. A, Western blots were probed with antibodies against
IRX5. qRT‐PCR of mRNA of IRX5. Graphs show mean SD. B, SW480 and DLD‐1 cells were seeded into 96‐well plates at the cell density of
5000 cells/well. Cells were incubated at 37°C for 0 to 96 hours. Then cells were added 10 µL of CCK8 solution to each well and incubated for
1 to 4 hours. Measure absorbance at OD= 450 nm. C, Cells were cultured in 37°C for 48 hours and stored in ethanol for 24 hours and then
stained and cell cycle profile was analyzed by flow cytometry. Graphs show mean SD. Asterisks represent significant differences. CCK8, cell
counting kit 8; GAPDH, glyceraldehyde 3‐phosphate dehydrogenase; IRX5, Iroquois homeobox gene 5; qRT‐PCR. quantitative real‐time
polymerase chain reaction; *P< .05; **P< .01; ***P< .001; n.s. not significant
4 | SUN ET AL.
positivity for the senescence‐associated β‐galactosidase
(SA‐β‐gal).20 SA‐β‐gal, this biomarker, was expressed in
senescent, but not in pre‐senescent or quiescent fibro-
blasts, nor in terminally differentiated keratinocytes. The
SA‐β‐gal activity was reliant on age, for an increase in
dermal fibroblasts and epidural keratinocytes from
humans of different ages.21 Meanwhile, lysosomal en-
zymes and lysosomal activity which regarded as one of
the hallmarks of senescence was partly consistent with
SA‐β‐gal activity in detecting cellular senescence.22 All
data suggest it was effective to identify senescent cells
through SA‐β‐gal. Indeed approximately 60% to 70% of
FIGURE 2 IRX5 induce cell cycle
arrest. A, Western blots were probed with
antibodies against, cyclin A2, cyclin B1,
cyclin D1, cyclin E1, p21, p53, and RH2A.
GAPDH was used as the loading control.
B, Qualification of Western blot in A. C, Cells
were fixed and stained with antibody against
RH2A. Images were captured using Axio
Scope A1. Scale bar, 100 µm. Graphs show
mean SD. DAPI, 4′,6‐diamidino‐
2‐phenylindole; GAPDH, glyceraldehyde
3‐phosphate dehydrogenase; IRX5, Iroquois
homeobox gene 5. Asterisks represent
significant differences; *P< .05; **P< .01;
***P< .001; n.s. not significant
SUN ET AL. | 5
IRX5‐overexpression cells exhibited positivity for the se-
nescence hallmark, SA‐β‐gal compared to control ones
(Figure 3A,C). Thus DNA damage and senescence are
triggered upon the overexpression of IRX5. It was re-
ported that senescent cells may promote tumor progres-
sion by creating a pro‐oncogenic inflammatory
microenvironment.23In conclusion, IRX5 provokes cel-
lular senescence which may promote tumor progression.
3.4 | Cellular senescence is triggered
by ATM
To evaluate whether ATM induced senescence we did
immunofluorescence in both cells. As we expected the
immunofluorescence staining of ATM increased in IRX5‐
overexpression cells compared with that in controls
(Figure 3B). Experimental studies were conducted to in-
vestigate whether ATM contributes to senescence and
cell growth rescue. In rescue experiments, we inhibited
ATM using siRNA. To confirm the inactivation of the
ATM pathway by siRNA, real‐time PCR was performed.
According to the efficiency of siRNA, we chose si1 in
SW480 and si4 in DLD‐1 (Figure S1A). Meanwhile, the
inhibition of ATM significantly reduced the RH2A
protein level (Figure 4B,C). Importantly, the inactivation
of ATM extenuated cellular senescence significantly and
promoted cell growth (Figure 4D, E, and F). Above all,
the senescence and cell growth activated in IRX5‐
overexpression cells were dependent on upstream DNA
damage signaling by ATM.
3.5 | IRX5 enhances drug resistance and
serum‐free resistance
According to data above, we consider IRX5 might play a
role in another process of the tumor. We evaluated the
effects of fluorouracil (5‐fu) on SW480 and DLD‐1 cells
and found that survival rate after treatment with 5‐fu was
markedly different between IRX5‐overexpression ones
and control ones. We treated cells with increasing
amounts of 5‐fu from 0 to 0.3 µg/mL in SW480 cells and
from 0 to 2 µg/mL in DLD‐1 cells. The SW480 and DLD‐1
control ones were relatively sensitive to 5‐fu treatment
with a survival rate from 80% to 50% and 90% to 40%,
respectively. Whereas the IRX5‐overexpression cells were
more resistant to 5‐fu treatment, with an approximately
one point five times and twofold, respectively, increase in
survival rate compared to the control ones (Figure 5A).
FIGURE 3 IRX5 provokes cellular
senescence in colorectal cancer cells. A, Cells
were washed twice with PBS, fixed with
fixation buffer for 15minutes at room
temperature, and stained with
β‐galactosidase detection solution overnight
at 37°C. B, Cells were fixed and stained with
antibody against ATM. Images were
captured using Axio Scope A1. Scale bar,
100 µm. C, Qualification of cells stained with
b‐galactosidase in A. Graphs show mean SD.
DAPI, 4′,6‐diamidino‐2‐phenylindole;
GAPDH, glyceraldehyde 3‐phosphate
dehydrogenase; IRX5, Iroquois homeobox
gene 5; PBS, phosphate buffered saline.
Asterisks represent significant differences.
*P< .05; **P< .01; ***P< .001; n.s. not
significant
6 | SUN ET AL.
These data indicated that IRX5‐overexpression cells are
more resistant to 5‐fu compared to control ones. Fur-
thermore, to demonstrate the resistance precisely we did
another experiment. Cells were maintained in DMEM
supplemented with 10% fetal bovine serum for 24 hours.
Then we cultured cells in DMEM without serum for
4 days and observed morphology and number of cells. IRX5‐
overexpression cells became more flatted in cell shape and
had larger number of cells than the control ones (Figure 5B).
The result implied that IRX5 could promote cell vitality in
the serum‐free situation. Above all, IRX5 enhances drug
resistance and serum‐free resistance.
4 | DISCUSSION
In this study, we identified that overexpression of IRX5 in
SW480 and DLD‐1 CRC cells exacerbated DNA damage
and genomic instability causing cell cycle arrest and se-
nescence through the DDR kinase ATM.
FIGURE 4 Cellular senescence is triggered by ATM. A, Cells were transfected with ATM small interfering RNA (siRNA) or
control siRNA and seeded into 96‐well plates at the cell density of 5000 cells/well. Cells were incubated at 37°C for 0 to 96 hours.
Then cells were added 10 µL of CCK8 solution to each well and incubated for 1 to 4 hours. Measure absorbance at OD = 450 nm.
B, Cells were transfected with ATM siRNA or control siRNA. Western blots were probed with antibodies against RH2A. GAPDH was
used as the loading control. C. Cells were fixed and stained with antibodies against RH2A. Images were captured using Axio Scope
A1. Scale bar, 100 µm. D, Experiment was done as described in Figure 3A. E, F. Qualification of cells stained with b‐galactosidase in
D. Graphs show mean SD. CCK8, cell counting kit 8; DAPI, 4′,6‐diamidino‐2‐phenylindole; GAPDH, glyceraldehyde 3‐phosphate
dehydrogenase; IRX5, Iroquois homeobox gene 5. Asterisks represent significant differences. *P < .05; **P < .01; ***P < .001; n.s. not
significant
SUN ET AL. | 7
Genomic instability of CRC can cause by three ways:
MSI, CIN, and CIMP. Alterations in chromosome seg-
regation, telomere dysfunction, and DNA damage
response are features of CIN. Also, alterations in CIN
affect critical genes like TP53. TP53, which encodes for
p53, the main cell‐cycle checkpoint, caused an un-
controlled entry in the cell cycle.2 In our study,
DNA damage response had been discovered in
IRX5‐overexpression cells and the level of p53 protein
was increased in IRX5‐overexpression cells which
means genomic instability could be caused by CIN.
DNA damage has been reported as the fundamental
basis of oncogenesis.24 Following DNA damage, the
break must be detected and the cell cycle could be ei-
ther transiently block progression, to allow time for
repair which needed DNA repair genes, or be with-
drawn.17 Apoptosis or senescence as outcomes of the
DNA damage response (DDR) drove the cell to exit
the cell cycle.25 In our study, RH2A protein level
accumulated in IRX5‐overexpression cells which
uncovered that IRX5 promoted DNA damage. The fol-
lowing changes in cyclin protein resulting from DNA
damage showed that cells may exit the cell cycle. That
was the reason why IRX5 inhibited cell growth.
Senescence is a state of stable proliferative arrest.23 It
has now been accepted that regardless of the telomere
state, the form of DNA damage and cellular stress,
whether caused by the presence of activated oncogenes,
unscheduled DNA replication, or oxidative stress, can
trigger a senescence phenotype. One cellular character-
istic during the senescence process is the accumulation of
unrepaired DNA damage and loss of genomic integrity.
Given that genomic integrity caused by DNA damage
triggers senescence progression. In our study, the level of
RH2A, the symbol of DSBs, and the level of SA‐β‐gal
were upregulated in IRX5‐overexpression cells. Although
senescence was initially discovered as a mechanism to
suppress tumors, it has now been determined that
senescent response can promote cancer progression.26
The senescence‐associated secretory phenotype (SASP)
FIGURE 5 Iroquois homeobox gene 5 has a bad influence on prognosis of colorectal cancer. A, Cells were seeded into 96‐well plates at
the cell density of 5000 cells/well and harvested at the indicated concentration of penta fluorouracil. Then cells were added 10 µL of cell
counting kit 8 solutions to each well and incubated for 1 to 4 hours. Measure absorbance at OD= 450 nm. B, Cells were harvested in six‐well
plates at the density of 1×105 cells/well and incubated without serum for 96 hours after 24 hours later. Graphs show mean SD. Asterisks
represent significant differences. *P< .05; **P< .01; ***P< .001; n.s. not significant
8 | SUN ET AL.
was involved in these effects requiring a significant in-
crease in the secretion of proinflammatory cytokines.
Factors such as NFkB, C/EBPb, mTOR, and MacroH2A.
1 and GATA4 regulated SAPA.20 SASP has been shown to
occur in cancer patients after receiving DNA damage
chemotherapy. Therefore, senescent cells promoted
tumor progression by secreting factors that create a pro‐
oncogenic inflammatory microenvironment. Failure to
properly respond to or repair DNA damage can lead to
genetic instability, which in turn may enhance the rate of
cancer development. After genomic instability occurs,
mutations of genes are not only occurred in cellular DNA
repair pathways, but are also involved in cellular DDR
mechanisms. Drug resistance and serum‐free resistanceoccurring in IRX5‐overexpression cells may due to a
wrong response or mutations in the DDR pathway. Large
scale sequencing and bioinformatics approaches also
have revealed a remarkable diversity of somatic muta-
tions, as well as errors in DNA damage response and
DNA repair in various cancers.
The decrease of cell number may repress tumor pro-
gression according to previous research, however, in our
study, cell growth was inhibited in IRX5‐overexpression
cells in which drug resistance and serum‐free resistance
happened. Mutation accumulating in G1/S arrest which
leads to inhibition of cell growth resulted in drug and
serum‐free resistance.
In summary, our studies imply IRX5 has a pro‐
tumorigenesis function through the ATM pathway
exacerbating genomic integrity. IRX5 overexpression in-
hibited cell growth in SW480 and DLD‐1 cell lines, in-
creased p21 and p53 protein expression, G1/S cell cycle
arrest, and enhanced senescent activity. Given that IRX5
is likely to be a new therapeutic target in cancer
treatment.
ACKNOWLEDGMENTS
This study was supported by grants from the Jiangsu Pro-
vincial Key Research Development Program (BE2016795),
National Natural Science Foundation of China (21577066),
and Jiangsu Provincial Key Medical Discipline (Laboratory).
CONFLICT OF INTERESTS
The authors declare that there are no conflict of interests.
AUTHOR CONTRIBUTIONS
XS and YW performed the experiments. JF and TW
participated in the design of this study. JW and RM
searched for important background information. HC,
ZW, and SL provided assistance for data acquisition
and data analysis. JZ drafted the manuscript. YW and
YZ preformed manuscript review. All authors read
and approved the final manuscript.
ORCID
Xun Sun http://orcid.org/0000-0002-9654-9473
REFERENCES
1. Siegel RL, Miller KD, Jemal A. Cancer statistics, 2018. CA
Cancer J Clin. 2018;68:7‐30.
2. Marmol I, Sanchez‐de‐Diego C, Pradilla Dieste A, Cerrada E,
Rodriguez Yoldi MJ. Colorectal carcinoma: a general overview
and future perspectives in colorectal cancer. Int J Mol Sci. 2017;
18(1):197.
3. Liu D, Pattabiraman V, Bacanamwo M, Anderson LM. Iroquois
homeobox transcription factor (Irx5) promotes G1/S‐phase
transition in vascular smooth muscle cells by CDK2‐dependent
activation. Am J Physiol Cell Physiol. 2016;311:C179‐C189.
4. Myrthue A, Rademacher BLS, Pittsenbarger J, et al. The ir-
oquois homeobox gene 5 is regulated by 1,25‐dihydroxyvitamin
D3 in human prostate cancer and regulates apoptosis and the
cell cycle in LNCaP prostate cancer cells. Clin Cancer Res. 2008;
14:3562‐3570.
5. Huang L, Song F, Sun H, Zhang L, Huang C. IRX5 promotes
NF‐jB signalling to increase proliferation, migration, and in-
vasion via OPN in tongue squamous cell carcinoma. J Cell Mol
Med. 2018;22:3899‐3910.
6. Martorell Ò, Barriga FM, Merlos‐Suárez A, et al. Iro/IRX
transcription factors negatively regulate Dpp/TGF‐beta path-
way activity during intestinal tumorigenesis. EMBO Rep. 2014;
15:1210‐1218.
7. Guo X, Liu W, Pan Y, et al. Homeobox gene IRX1 is a tumor
suppressor gene in gastric carcinoma. Oncogene. 2010;29:3908‐3920.
8. Jiang J, Liu W, Guo X, et al. IRX1 influences peritoneal
spreading and metastasis via inhibiting BDKRB2‐dependent
neovascularization on gastric cancer. Oncogene. 2011;30:
4498‐4508.
9. Xu X, Hussain WM, Vijai J, et al. Variants at IRX4 as prostate
cancer expression quantitative trait loci. Eur J Human Genet.
2014;22:558‐563.
10. Liu T, Zhou W, Zhang F, et al. Knockdown of IRX2 inhibits
osteosarcoma cell proliferation and invasion by the AKT/
MMP9 signaling pathway. Mol Med Rep. 2014;10:169‐174.
11. Liu T, Zhou W, Cai B, et al. IRX2‐mediated upregulation of
MMP‐9 and VEGF in a PI3K/AKT‐dependent manner. Mol
Med Rep. 2015;12:4346‐4351.
12. Wang P, Zhuang C, Huang D, Xu K. Downregulation of
miR‐377 contributes to IRX3 deregulation in hepatocellular
carcinoma. Oncol Rep. 2016;36:247‐252.
13. Liu T, Zhang X, Yang YM, Du LT, Wang CX. Increased expression
of the long noncoding RNA CRNDE‐h indicates a poor prognosis
in colorectal cancer, and is positively correlated with IRX5 mRNA
expression. Onco Targets Ther. 2016;9:1437‐1448.
14. Zhu L, Liu Y, Chen Q, et al. Long‐noncoding RNA colorectal
neoplasia differentially expressed gene as a potential target to
upregulate the expression of IRX5 by miR‐136‐5P to promote
oncogenic properties in hepatocellular carcinoma. Cell Physiol
Biochem. 2018;50:2229‐2248.
15. Zhang DL, Qu LW, Ma L, et al. Genome‐wide identification of
transcription factors that are critical to non‐small cell lung
cancer. Cancer Lett. 2018;434:132‐143.
16. Andor N, Maley CC, Ji HP. Genomic instability in cancer: teetering
on the limit of tolerance. Cancer Res. 2017;77:2179‐2185.
SUN ET AL. | 9
http://orcid.org/0000-0002-9654-9473
17. Shaltiel IA, Krenning L, Bruinsma W, Medema RH. The same,
only different ‐ DNA damage checkpoints and their reversal
throughout the cell cycle. J Cell Sci. 2015;128:1‐14.
18. Deng CX. BRCA1: cell cycle checkpoint, genetic instability,
DNA damage response and cancer evolution. Nucleic Acids Res.
2006;34:1416‐1426.
19. Vijayalakshmi A, Sindhu G. Umbelliferone arrest cell cycle at G0/
G1 phase and induces apoptosis in human oral carcinoma (KB)
cells possibly via oxidative DNA damage. Biomed Pharmacother.
2017;92:661‐671.
20. Krishnan V, Chong YL, Tan TZ, et al. TGFbeta promotes genomic
instability after loss of RUNX3. Cancer Res. 2018;78:88‐102.
21. Itahana K, Itahana Y, Dimri GP. Colorimetric detection of
senescence‐associated beta galactosidase. Methods Mol Biol.
2013;965:143‐156.
22. Desprez AR, Coppe JP, Campisi J, Desprez PY. Senescent cells
as a source of inflammatory factors for tumor progression.
Cancer Metastasis Rev. 2010;29:273‐283.
23. Acosta JC, O'Loghlen A, Banito A, et al. Chemokine signaling
via the CXCR2 receptor reinforces senescence. Cell. 2008;133:
1006‐1018.
24. Barr AR, Cooper S, Heldt FS, et al. DNA damage during
S‐phase mediates the proliferation‐quiescence decision in the
subsequent G1 via p21 expression. Nat Commun. 2017;8:14728.
25. Ou HL, Schumacher B. DNA damage responses and p53 in the
aging process. Blood. 2017;131:488‐495.
26. Piechota M, Sunderland P, Radwanska K, Wysocka A,
Sikora E. Is senescence‐associated β‐galactosidase a marker
of neuronal senescence. Oncotarget. 2016;7:81099‐81109.
SUPPORTING INFORMATION
Additional supporting information may be found online
in the Supporting Information section.
How to cite this article: Sun X, Jiang X, Wu J,
et al. IRX5 prompts genomic instability in
colorectal cancer cells. J Cell Biochem. 2020;1–10.
https://doi.org/10.1002/jcb.29693
10 | SUN ET AL.
https://doi.org/10.1002/jcb.29693