Escreva a sequência de RNA que será formada a partir da sequência de DNA abaixo: AAATTTCGCGATCGGATCCGA ???

#celulas
#citoplasma
#membrana-plasmatica
#divisão-celular
#estudo-da-celula
Disciplina:Biologia Celular1.519 materiais