Continue navegando
Prévia do material em texto
DETERMINANTES DA ESTRUTURAÇÃO POPULACIONAL EM ESPÉCIES BRASILEIRAS DO GÊNERO Necromys (RODENTIA, CRICETIDAE) JÂNIO CORDEIRO MOREIRA RIO DE JANEIRO SETEMBRO, 2015 ii JÂNIO CORDEIRO MOREIRA DETERMINANTES DA ESTRUTURAÇÃO POPULACIONAL EM ESPÉCIES BRASILEIRAS DO GÊNERO Necromys (RODENTIA, CRICETIDAE) Tese de Doutorado apresentada ao Programa de Pós- Graduação em Biodiversidade e Biologia Evolutiva, Universidade Federal do Rio de Janeiro, como parte dos requisitos necessários à obtenção do título de Doutor em Biodiversidade e Biologia Evolutiva. Orientador: Prof. Dr. João Alves de Oliveira RIO DE JANEIRO SETEMBRO, 2015 iii Jânio Cordeiro Moreira DETERMINANTES DA ESTRUTURAÇÃO POPULACIONAL EM ESPÉCIES BRASILEIRAS DO GÊNERO Necromys (RODENTIA, CRICETIDAE) Tese de Doutorado apresentada ao Programa de Pós-Graduação em Biodiversidade e Biologia Evolutiva, Universidade Federal do Rio de Janeiro, como parte dos requisitos necessários à obtenção do título de Doutor em Biodiversidade e Biologia Evolutiva Orientador: Dr. João Alves de Oliveira, Museu Nacional/UFRJ Aprovada por: Presidente da Banca iv FICHA CATALOGRÁFICA MOREIRA, Jânio Cordeiro Determinantes da estruturação populacional em espécies brasileiras do gênero Necromys (Rodentia, Cricetidae) Rio de Janeiro, UFRJ, 2015. xvii+107pp. Orientador: Prof. Dr. João Alves de Oliveira Tese de Doutorado, Programa de Pós-Graduação em Biodiversidade e Biologia Evolutiva, UFRJ, 2015. Palavras-chave: 1. Necromys lasiurus 2. Necromys lenguarum 3. Sigmodontinae 4. ratadas 5. estruturação geográfica 6. Pleistoceno I. João Alves de Oliveira II. Universidade Federal do Rio de Janeiro, Programa de Pós-Graduação em Biodiversidade e Biologia Evolutiva III. Determinantes da estruturação populacional em espécies brasileiras do gênero Necromys (Rodentia, Cricetidae) v AGRADECIMENTOS Antes de qualquer coisa, o período de quatro anos referente ao desenvolvimento dessa tese representou um tempo de amadurecimento profissional e pessoal. Durante o curso tive contato com novas técnicas e procedimentos. Todo esse aprendizado não seria possível sem o suporte e o apoio de diversas pessoas. O presente trabalho é, sem dúvida, o somatório do esforço, ajuda e experiência que recebi de todas elas ao longo desses últimos anos. Embora muitas dessas pessoas não sejam citadas nominalmente aqui, gostaria de registrar o meu agradecimento pela contribuição de cada uma delas. Sou grato ao meu orientador Dr. João Alves de Oliveira por mais de uma década de orientação e amizade em que partilhamos o entusiasmo pelo estudo das “ratadas” e por outras questões envolvendo os pequenos mamíferos. À Drª Cibele R. Bonvicino pela amizade e incentivo, pelas oportunidades oferecidas, pela paciência em esperar o demorado processo de análise dos dados e de escrita de manuscritos, pelas amostras cedidas e por viabilizar o acesso à estrutura laboratorial do Inca e da Fiocruz. Ao Dr. Hector Abreu por possibilitar o acesso à estrutura laboratorial do Inca e por ter solicitado uma bolsa de capacitação técnica junto à FAPERJ que permitiu meu treinamento inicial nas técnicas de Biologia Molecular e foi fundamental para o meu ingresso no doutorado. Ao Dr. Miguel Moreira por estar sempre disposto a esclarecer as dúvidas em relação ao uso dos equipamentos e das análises moleculares. Aos Drs. Marcelo Weksler, Paulo Buckup e Bryan Jennings por possibilitarem o acesso à estrutura laboratorial do Departamento de Vertebrados do Museu Nacional. vi Ao Dr. Paulo Sérgio D’Andrea pelas amostras cedidas e por possibilitar a utilização das instalações e equipamentos do Laboratório de Biologia e Parasitologia de Mamíferos Silvestres Reservatórios do IOC-Fiocruz. Ao Roberto Vilela e Daniela Dias pela ajuda na localização das amostras na Fiocruz. Aos amigos Júlio, Bia Mello, Fabrícia Nascimento, Albert Menezes, Ana Lazar, Fernanda Pedone, Fabiana Caramaschi, Fabiana Batalha, Maria Carolina, Carolina Furtado, Sergio Amaro, Leila Monnerat, Kelly Rose, Michel Faria et al., por partilharem seu conhecimento sobre os métodos moleculares e pelas conversas sempre bem- humoradas. Ao Pablo Gonçalves pela amizade, pela cessão de amostras, pela participação na minha banca de qualificação e por ter sido meu mentor inicial no mundo da Mastozoologia. Aos Drs. Carlos Guerra, Carlos Renato Ventura, Maria Lucia Lorini e Carlos Grelle pela participação na banca de qualificação e pelas críticas e sugestões que contribuíram para aumentar a qualidade do manuscrito que compõe o capítulo II dessa tese. Aos membros da banca de tese por aceitarem o convite e pelas valiosas sugestões que ajudarão a melhorar esse documento. A todos os professores que em todos os níveis de minha caminhada escolar influenciaram-me, dividindo comigo seus conhecimentos. Ao Heber pela ajuda e esclarecimento nos procedimentos burocráticos relativos à tese. Aos colegas de laboratório no Museu Nacional, Inca e Fiocruz pelos excelentes anos de convivência, pelo bom humor constante e pela presteza em ajudar no que fosse preciso. vii Aos colegas do Instituto Federal do Paraná/Campus Palmas, especialmente aos membros do colegiado do curso de Licenciatura em Ciências Biológicas, pelo esforço em viabilizar minha chegada em Palmas, pela acolhida e pelo apoio durante a minha instalação na cidade. A meus pais Jair & Eldiris pelo exemplo, carinho, esforço, dedicação e incentivo ao longo de toda a minha vida. Sem vocês não teria sido possível alcançar tantas vitórias. Às minhas irmãs Janice e Jeíce, ao meu cunhado José Antônio e meu sobrinho Olavo pelo carinho e companheirismo. À minha querida esposa Giselle pelo carinho, compreensão e incentivo. Ao meu filho Paulo Henrique por sua curiosidade e alegria espontâneas, por sua inocência infantil que me traziam de volta ao mundo real estimulando-me a buscar ser cada dia melhor. Ao Sr. João, Dona Vera e João Diego pela acolhida e amizade. À FAPERJ por ter concedido ao meu orientador uma bolsa de apoio à pesquisa 1 (APQ1) cujos recursos custearam boa parte do fase laboratorial dessa tese. À CAPES pela bolsa de doutorado. viii RESUMO Determinantes da estruturação populacional em espécies brasileiras do gênero Necromys (Rodentia, Cricetidae) Jânio Cordeiro Moreira Orientador: João A. de Oliveira A escassez de informações sobre diferentes aspectos da biologia básica (e.g. estratégia reprodutiva, vagilidade) dos roedores da subfamilia Sigmodontinae tem dificultado um melhor entendimento tanto dos padrões de demografia, distribuição geográfica e diversidade atuais quanto de sua história evolutiva. Uma alternativa eficaz para acessar essas informações tem sido o uso de ferramentas moleculares como a análise de sequencias de genes mitocondriais e nucleares bem como a genotipagem de locos de microssatélites. Dentre os alvos potenciais para tais estudos destacam-se espécies sujeitas a uma dinâmica populacional complexa, caracterizada por explosões populacionais em curtos intervalos de tempo denominadas "ratadas". Nesse sentido, o objetivo do presente projeto foi avaliar o impacto dessas irrupções populacionais sobre a estrutura populacional e diversidade genética em Necromys lasiurus (Lund, 1840), espécie ubíqua e comprovadamente sujeita a “ratadas”, e Necromys lenguarum (Thomas, 1898), sua espécie-irmã geralmente não associada a tais oscilações demográficas. Foram obtidas sequências de cit b, adh1 e fgbi7 de amostras representativas da distribuição das espécies bem como genótipos de espécimes N. lasiurus de oito localidades. As análises filogenéticas com citocromo b revelaram a ocorrência de N. lenguarum no centro-oeste e norte do Brasilbem como alta estruturação em N. lasiurus com cinco grupos populacionais segundo disjunções norte-sul e leste-oeste do Cerrado. Esse arranjo geográfico foi confirmado nas análises multivariadas envolvendo o cit b e os locos de microssatélites. Embora estruturados, esses grupos apresentaram alta diversidade genética. Em N. lenguarum, há pouca diferenciação entre as populações e baixa diversidade genética. Infere-se que essas diferenças entre as espécies sejam reflexo de diferenças em sua biologia básica, especialmente no que se refere às ratadas. Em N. lasiurus, as ratadas podem permitir a conexão de subpopulações próximas mantendo elevados níveis diversidade genética em um nível regional. Essa hipótese precisa ser testada a partir de estudos de longo prazo visando analisar a variação temporal na ix diversidade genética da espécie em escala local e regional. Esses estudos devem amostrar o período antes, durante e depois das ratadas. Palavras–chave: Necromys, akodontini, ratadas, análises multivariadas, estruturação geográfica, biologia molecular. x ABSTRACT Determinants of population structure in Brazilian species the genus Necromys (Rodentia, Cricetidae) Jânio Cordeiro Moreira Orientador: João A. de Oliveira Some aspects of the natural history of the rodents of the subfamily Sigmodontinae remain elusive (e.g., reproductive strategies, vagility) hindering a better understanding of their demography, geographic range and evolutionary history. The use of molecular tools such as the analysis of sequences of mitochondrial and nuclear markers and genotyping of microsatellite loci has been pointed as an efficient way to deal with this issue. This approach is potentially useful to study some species experiencing population outbreaks locally termed as “ratadas”. In this sense, the present study aimed to assess the relevance of these density fluctuations on the population structure and genetic diversity in Necromys lasiurus, an ubiquitous species subjected to “ratadas”, and its sister species Necromys lenguarum for which there are no reports of such demographic oscillations. We obtained sequences of the markers cytochrome b, alcohol desydrogenase 1 and the beta fibrinogen intron 7, for an extended geographic sampling of these species as well as the genotypes of N. lasiurus specimens from eight localities. The phylogenetic analyses using cyt b revealed the occurrence of N. lenguarum in Central Brazil and the strong genetic structure of N. lasiurus in five haplogroups according north-south and west-east disjunctions in Cerrado. Multivariate analyses on both cyt b and microsatellite loci also revealed this geographic arrangement. These five haplogroups show high genetic diversity. N. lenguarum showed no geographic structure and low genetic diversity. We hypothesize that the distinct patterns of population structure and genetic diversity in N. lasiurus and N. lenguarum are due to subtle differences in the biology of these species including the occurrence of “ratadas”. In N. lasiurus, the outbreaks might allow the connection of neighbor subpopulations guaranteeing the maintenance of high levels of genetic diversity in a regional scale. However, this hypothesis requires additional tests in long term surveys aiming to assess the temporal variation in the genetic diversity of the species in both a local and regional scales. Future studies should include pre-outbreak, outbreak and post-outbreak samples. xi Key words: Necromys, akodontini, “ratadas”, rodent outbreaks, multivariate analysis, genetic structure, molecular biology. xii LISTA DE FIGURAS Figure 1. Geographical provenance of the Necromys lasiurus (black circles) and Necromys lenguarum (black diamonds) samples examined used in this study in relation to the current geographic boundaries of the three major Dry Diagonal formations mentioned in the text (Chaco, Cerrado and Caatinga). Localities are numbered sequentially from north to south (see Appendix S1). Figure 2. a) Bayesian and maximum likelihood cytochrome b (cytb) gene tree for Necromys lasiurus (800–1140 bp) and Necromys lenguarum (800 bp). Each N. lasiurus lineage for the mtDNA revealed by phylogenetic analyses was represented by a different color (green, central northern clade; red, western Cerrado clade; orange, central Cerrado clade; light blue, central eastern clade; dark blue, south-southeastern clade). Other Necromys (N. amoenus, N. lactens, N. obscurus and N. urichi) and akodontine species were included as outgroups (see Appendix S1 for details). For SH-aLRT (left semi-circles), grey indicate values from 0.7–0.9, black indicate values ≥ 0.9. For Bayesian statistics (right semi-circles), white indicate Bayesian Posterior Probability (BPP) 0.75–0.95, whereas black indicates BPP > 0.95. b) Geographic range of the lineages based on the examined samples highlighting their similarity with c) the phytogeographical regions of Cerrado and d) presumably stable areas in the Last Glacial Maximum. Figure 3. a) N. lasiurus Neighbour-Net networks showing haplotypes arranged in five groups corroborating the results of phylogenetic analysis (b). Haplogroups are colored according the Fig. 2 and labelled such as defined in the text. Large loops imply areas of phylogenetic uncertainty or reticulations. Their frequency in the network suggests that the relevance of hybridization for the evolution of the species still needs to be evaluated. Figure S1. ML and BI topology based on cytochrome b sequence data showing the phylogenetic relationships in Necromys. Figure S2. ML trees for beta fibrinogen intron 7 (a) and alcohol desydrogenase (b). Colours correspond to N. lasiurus haplogroups colours in Fig. 1a. Grey circles indicate SH- aLRT estimates from 0.7–0.9, black indicate SH-aLRT ≥ 0.9. xiii Figure S3: Neighbor-Net network reconstructed with basis on the cytb sequence data from Necromys lenguarum individuals. The star-shape of the network suggests the absence of geographic structure and a demographic expansion in this species. Figure S4 – Results of sPCA based on the cytochrome b sequence data of Necromys lenguarum. (a–b) First and second global scores of sPCA. Positive and negative sPC scores are depicted as black and white squares respectively. The size of squares is proportional to the absolute value of the sPC scores. Plots also show the connection network produced by Delaunay triangulation based on geographic coordinates of the 11 sampling localities examined in this study, (c) bar plots showing each component ordered by eigenvalue, and (d) scree plots of sPC eigenvalues decomposed into their variance and spatial autocorrelation components. Figure S5 – Results of sPCA based on the cytochrome b sequence data of Necromys lasiurus. (a–b) First and second global scores of sPCA. Positive and negative sPC scores are depicted as black and white squares respectively. The size of squares is proportional to the absolute value of the sPC scores. Plots are positioned according to the spatial coordinates of all 37 sampling localities examined in this study, (c) bar plots showing each component ordered by eigenvalue, and (d) scree plots of sPC eigenvalues decomposed into their variance and spatial autocorrelation components. Figure S6. Observed (white bars) and expected (dashed lines) mismatch distributions for the 4 main clades of N. lasiurus (a-d) and for N. lenguarum. Additional details are provided in the Table 1. Figure S7. Collecting localities for the Necromys lasiurus specimens which were genotyped in this study. Localities are numbered sequentially from north to south such as listed in the Table S7. Figure S8 – Results of sPCA based on the genotypes of six microsatellite loci in Necromys lasiurus.(a–b) First and second global scores of sPCA. Positive and negative sPC scores are depicted as black and white squares respectively. The size of squares is proportional to the absolute value of the sPC scores. Plots also show the connection network produced by xiv Delaunay triangulation based on geographic coordinates of the 8 sampling localities examined in this study, (c) bar plots showing each component ordered by eigenvalue, and (d) Scree plots of sPC eigenvalues decomposed into their variance and spatial autocorrelation components. xv LISTA DE TABELAS Table 1. Molecular diversity indices. neutrality and demographic tests to investigate population size changes for samples of N. lenguarum, N. lasiurus and all N. lasiurus haplogroups. Sample size (n); number of haplotypes (nh); haplotype diversity (h); nucleotide diversity (π); standard deviation (SD); Tajima’s D (D); Fu’s Fs ( Fs); sum of squared deviation (SSD); Harpending’s raggedness index (Hr); probability values (p); non- applicable (NA). Bold values are statistically significant. Table 2. Analysis of molecular variance (AMOVA) results of variation partitioning in N. lasiurus according four tested scenarios: a) 3 groups: (CE+CC), (CN+CW), SS; b) 4 groups A: CE, CC, (CN+CW), SS; c) 4 groups B: (CE+CC), CN, SS, CW; d) 5 groups: CE, CC, CN, SS, CW. Bold values were statistically significant with p < 0.001. Table 3. Pairwise Fst values (below diagonal) among the Necromys lasiurus mt-DNA haplogroups. Bold values of Fst were statistically significant with p < 0.001. Table S1 Sample identification, genetic information (cytb haplotype and mtDNA clade assignment), geographic references (latitude, longitude, localities), and source for each (a) Necromys lasiurus and (b) N. lenguarum specimens. Acronyms refer to collector’s name: LG and CD= L. Geise (Departamento de Zoologia, Instituto de Biologia, Universidade Estadual do Rio de Janeiro - UERJ, Brazil); CRB, SVS and LBCE= C.R. Bonvicino (LBCE, Instituto Oswaldo Cruz – Fiocruz, Rio de Janeiro, Brazil); ARB = A. Bezerra (Instituto Oswaldo Cruz – Fiocruz, Rio de Janeiro, Brazil). Table S2 (a) List of samples of Necromys lasiurus with sequences of nuclear markers and examined cytb sequences of other Necromys species; (b) outgroup species in both phylogentic and molecular dating analyses. Acronyms refer to collector’s number: LG and CD= L. Geise (Departamento de Zoologia, Instituto de Biologia, Universidade Estadual do Rio de Janeiro - UERJ, Brazil); CRB, SVS and LBCE= C.R. Bonvicino (LBCE, Instituto Oswaldo Cruz – Fiocruz, Rio de Janeiro, Brazil); ARB = A. Bezerra (Instituto Oswaldo xvi Cruz – Fiocruz, Rio de Janeiro, Brazil); LMT = Liliani Marília Tiepolo (Universidade Federal do Paraná - UFPR, Paraná, Brazil). Na = non-aplicable Table S3 Gazetteer of collecting localities and specimens examined in the microsatellite analysis. Numbers in brackets refers to localities mapped in Figure S7. Localities are numbered from north to south, followed by latitude and longitude (south and west, respectively, in negative decimal degrees). States are listed in bold uppercase, followed by specific localities in roman and municipalities in bold, with reference coordinates of the municipality headquarters. Uncatalogued specimens will be deposited in the collections of the Museu Nacional, Universidade Federal do Rio de Janeiro (CRB and LBCE) and Museu João Moojen, Universidade Federal de Viçosa (PRG = Pablo Rodrigues Gonçalves, NUPEM/UFRJ). Table S4. Estimated geographic range size for N. lenguarum, N. lasiurus and all N. lasiurus lineages. Most Necromys species have medium-sized ranges (Pardiñas et al., 2015) and only two haplogroups (CC and CW) appear to follow this pattern. The other lineages have ranges larger than 500,000 km2. Table S5. Uncorrected average pairwise sequence divergence among (below diagonal) and within (bold in diagonal) cytb clades of Necromys lasiurus. Table S6. Results of the Mantel tests comparing the matrices of genetic and geographic distances carried out for the five N. lasiurus haplogroups. r2 = Pearson's correlation coefficient; p = probability. Table S7. Characteristics of the six polymorphic microsatellite markers amplified in Necromys lasiurus. Ta (⁰C) = annealing temperature, NC= number of cycles. xvii SUMÁRIO Agradecimentos..........................................................................................................................V Resumo...................................................................................................................................VIII Abstract.......................................................................................................................................X Introdução...................................................................................................................................1 1.1 Objetivos...................................................................................................................8 CAPÍTULO I: 1º Artigo – Isolation of polymorphic microsatellite loci in Akodon cursor (Cricetidae, Sigmodontinae) and cross-amplification in other akodontine rodents….......19 CAPÍTULO II: 2º Artigo – Pleistocene climate changes and the diversification of lowland species of the rodent genus Necromys in South American Dry Diagonal formations.............31 Considerações Finais......................................................................................................,,.......104 Conclusões...............................................................................................................................106 1 1. Introdução Amplamente distribuídos pela América do Sul e contando com representantes nas Américas Central e do Norte, os roedores da Subfamília Sigmodontinae formam um grupo bastante heterogêneo com relação a características como hábitos alimentares, seleção e uso do habitat, estratégia reprodutiva, padrões de migração e dispersão, entre outros (Pardiñas et al., 2002). Grupos apresentando tal nível de heterogeneidade podem exibir padrões de estruturação populacional bastante distintos (Costello et al., 2003). A capacidade de uma espécie de modificar o seu padrão reprodutivo e, consequentemente, seu tamanho populacional e níveis de migração em resposta a estímulos ambientais dependem de quão flexível sua história natural pode ser, Desse modo, conhecer a biologia básica da espécie a ser estudada é importante para a compreensão tanto dos padrões de demografia e diversidade atuais quanto de sua história evolutiva (Costello et al.,2003). Nesse sentido, uma questão relativa aos roedores da subfamília Sigmodontinae que se enquadra na situação descrita acima refere-se ao fenômeno das ratadas – episódios de flutuação populacional durante os quais, em um curto intervalo de tempo, as populações desses organismos podem atingir um tamanho várias vezes maior do que o normal – e o seu impacto sobre a ecologia e evolução das espécies (Pearson et al., 2002). Uma ideia da dimensão desse aumento populacional pode ser obtida pela análise dos números registrados por Gallardo & Mercado (1999) durante um desses eventos em Puerto Cárdenas/Chile, onde, em apenas uma noite, 2000 espécimes foram coletados. Após uma semana de irrupção o número de indivíduos coletados chegou a aproximadamente 12000 e outros milhares invadiram habitações humanas. Apesar de sua amplitude e da existência de registros de tais irrupções populacionais em diferentes regiões da América do Sul desde o período colonial, o 2 conhecimento sobre esse fenômeno permanece limitado (Pearson, 2002). Na ausência de uma definição quantitativa do que pode ser considerado uma "ratada", essa classificação têmsido feita de modo arbitrário e os registros de sua ocorrência muitas vezes são realizados por acaso (Jaksic & Lima, 2003). Aparentemente, as ratadas constituem um fenômeno efêmero, não necessariamente sincrônico, tipicamente local, afetando localidades contíguas ou estendendo-se por distâncias de até 300 quilômetros, cuja ocorrência está associada a uma disponibilidade aumentada de fontes alimentares utilizadas por esses roedores (González et al., 2000; Pearson, 2002). Esse suprimento adicional pode estar relacionado à produção maciça de flores e sementes de algumas espécies de bambu ou ao incremento na produtividade ambiental primária decorrente de mudanças no regime pluviométrico durante períodos de El Niño e La Niña e, não necessariamente, produz os mesmos efeitos em todas as espécies de uma localidade (Lima et al., 1999; Jaksic & Lima, 2003; Sage et al., 2007). De modo geral, a falta de conhecimento sobre os mecanismos desencadeantes, periodicidade, tempo de duração, amplitude geográfica e magnitude dificulta a caracterização e detecção adequada desses eventos de explosão demográfica (Jaksic & Lima, 2003). Assim, para que se possa compreender a dinâmica das ratadas bem como suas possíveis consequências ecológicas e evolutivas é necessário empreender estudos para conhecer os fatores exógenos como o clima e floração de bambus, mas principalmente os fatores intrínsecos responsáveis não apenas por capacitar uma espécie a responder ao estímulo ambiental e produzir tal aumento populacional como também por regular a intensidade dessa resposta (Vessey & Vessey, 2007). 3 Todavia, tal informação sobre a biologia básica está ausente para a maior parte das espécies, sendo necessária a realização de estudos de campo visando o monitoramento das populações in loco, que geralmente apresentam alto custo devido ao longo prazo de estudo necessário, e/ou de estudos de genética de populações para a obtenção de estimativas de parâmetros populacionais tais como taxa de migração e tamanho efetivo que possibilitem a redução dessa lacuna de conhecimento (Slatkin, 1985, 1987; Neigel, 1997). Nas últimas décadas, o desenvolvimento da Biologia Molecular tem contribuído para modificar esse cenário por possibilitar o aperfeiçoamento dos métodos baseados na análise de marcadores genéticos tornando-os mais acurados, rápidos e baratos (Johnson & Black, 1995). Dentre esses marcadores destacam-se as unidades de sequências repetidas em tandem, os microssatélites, devido a propriedades como alta variabilidade alélica, densa distribuição no genoma e possibilidade de amplificação a partir de iniciadores desenvolvidos para outras espécies (Jarne & Lagoda, 1996; Garza et al., 1997; Chapuis et al., 2008, 2011; Cullingham et al., 2008). Em conjunto, essas características tornam os microssatélites marcadores adequados para a realização de análises populacionais em uma escala temporal e espacial mais refinada em relação àquela considerada no sequenciamento de genes (Deter et al., 2008). Nesse sentido, considerando-se a complexidade das ratadas, analisar a variabilidade genética de algumas espécies associadas a esse fenômeno usando tanto locos de microssatélites quanto sequencias de genes como o citocromo b pode ajudar a esclarecer a relação entre explosões populacionais e estruturação geográfica. Apesar de seu potencial, ainda há poucos locos de microssatélites descritos para os membros da Subfamília Sigmodontinae, destacando-se: Akodon azarae (Vera et al., 2011), 4 Calomys musculinus (Chiappero et al., 2005, 2011), Nectomys squamipes (Almeida et al., 2001; Maroja et al., 2003) e Oligoryzomys longicaudatus (González-Ittig et al., 2008). Alguns desses locos foram amplificados com sucesso em outros representantes da subfamília, incluindo algumas espécies envolvidas em ratadas, sendo potencialmente úteis como ferramentas para estudos de genética de populações nesses organismos. Entre os fatores possivelmente responsáveis pela escassez de estudos avaliando a variação temporal na diversidade genética de espécies envolvidas em ratadas pode-se destacar a falta desses marcadores ou a ausência de testes efetivos da utilidade de iniciadores heterólogos para esses estudos. De fato, até o momento, avaliações desse tipo estão limitadas a dois estudos em Oligoryzomys longicaudatus em que foram utilizadas sequências da região controle da mitocôndria (Boric-Bargetto et al., 2012) e locos de microssatélites (González-Ittig et al., 2015). Contudo, a análise concomitante de sequencias e locos de microssatélites ainda não foi realizada em nenhum estudo. Apesar disso, parece haver uma conexão entre uma dinâmica populacional complexa envolvendo oscilações dramáticas no tamanho populacional, padrões de dispersão e estruturação populacional em espécies de roedores sinantrópicos como Mus musculus (Singleton et al., 2010) e Rattus rattus (Aplin & Lalsiamliana, 2010), com representantes das demais subfamílias de Cricetidae registrados no hemisfério norte como Arvicola (Berthier et al., 2005, 2006), Lemmus (Ehrich & Jorde, 2005), Myodes (Guivier et al., 2011) e Peromyscus (Vessey & Vessey, 2007) e em insetos (Harrison, 1997; Lovett et al., 2002; Chapuis et al., 2008, 2009). De modo geral, estas pesquisas revelam que, durante os episódios de alta populacional, pode haver um incremento na intensidade e distância de movimentos migratórios e o restabelecimento de fluxo gênico entre populações anteriormente isoladas 5 provocando a recuperação da diversidade genética da espécie e reduzindo as diferenças entre as populações (Ehrich & Jorde, 2005; Dong et al., 2010; Chapuis et al., 2011). No entanto, tanto a abrangência geográfica quanto a intensidade do possível efeito homogeneizante dessas irrupções populacionais dependerão da habilidade da espécie de dispersar tendendo a serem mais acentuados em espécies altamente vágeis e mais restritas naquelas espécies com menor capacidade de migração (Ronnàs et al., 2011). De fato, diferenças sutis em fatores como vagilidade e generalismo relativo à seleção, uso e preferência por determinados hábitats parecem ser uma explicação plausível para os padrões de estruturação espacial distintos observados em algumas espécies envolvidas em ratadas (Palma et al., 2010; Boric-Bargetto et al., 2012; Gonzalez-Ittig et al., 2015). Dentre esses padrões, destacam-se: 1) a ausência de diferenciação populacional pronunciada em diferentes marcadores verificada em espécies com ampla distribuição geográfica como Oligoryzomys longicaudatus (Palma et al., 2005; González-Ittig et al., 2010) e Necromys lasiurus (Macêdo & Mares, 1987; D'Elia et al., 2008), 2) o contraste entre tendências de conservadorismo citogenético e morfológico e de divergência molecular em espécies como Abrothrix longipilis (Palma et al., 2010), Akodon montensis (Lara et al., 2005) e Euryoryzomys russatus (Miranda et al., 2007; Libardi & Percequillo, 2008), 3) a falta de suporte morfológico e/ou molecular (Ventura et al., 2010; Moreira & Oliveira, 2011) para a possível descontinuidade cromossômica de uma população de Thaptomys nigrita localizada no extremo setentrional da distribuição com relação às amostras do sul e sudeste do Brasil (Ventura et al., 2004). Esses resultados reforçam a necessidade de aprofundar o conhecimento sobre a história natural das espécies envolvidas ou não em ratadas como forma de entender a relação entre tais fatores intrínsecos e esse fenômeno bem como delimitar seu papel no 6 processo de evolução e estruturação populacional desses organismos e na disseminação de agentes patogênicos aos quais alguns deles estão associados (e.g. esquistossomose, hantavirose). Nesse sentido, considerando-se a escassez de informações relativas à biologia básica das espécies de roedores da subfamília Sigmodontinae, especialmente aquelas envolvidas emratadas, e da importância desse conhecimento para a caracterização adequada, detecção precoce e compreensão desse fenômeno e de suas possíveis consequências ecológicas, epidemiológicas e evolutivas, a presente tese de doutorado propôs a obtenção de sequencias de citocromo b, de dois marcadores nucleares (álcool desidrogenase I e intron 7 da cadeia do beta-fibrinogênio) e a genotipagem de locos de microssatélites previamente desenvolvidos para outros representantes da subfamília Sigmodontinae para realizar estudos de genética de populações e filogeografia em Necromys lasiurus (Lund, 1840), espécie ubíqua e comprovadamente sujeitas a tais oscilações demográficas, e Necromys lenguarum (Thomas, 1898), sua espécie-irmã geralmente não associada a ratadas. A tese está estruturada em uma introdução geral do tema a ser estudado – as ratadas e estruturação populacional, dois capítulos referentes aos artigos produzidos ao longo do estudo, considerações finais e conclusões. O primeiro capítulo apresenta a descrição de sete locos de microssatélites desenvolvidos para Akodon cursor (Winge, 1887) e os resultados dos testes de amplificação cruzada dos mesmos em três outras espécies da tribo Akodontini, incluindo N. lasiurus. Esses locos foram utilizados para análises populacionais em N. lasiurus e N. lenguarum. Os resultados dessas análises, especialmente em relação à estruturação populacional, e sua comparação com os dados obtidos a partir de sequências de citocromo b 7 fazem parte do capítulo final da tese. Nesse segundo capítulo, são discutidas as possíveis causas dos padrões de estruturação populacional observados em N. lasiurus e N. lenguarum e infere-se a possível contribuição dos eventos climáticos do Pleistoceno e das ratadas na determinação das diferenças de diversidade genética dessas duas espécies. 1.1. Objetivos Este estudo objetivou avaliar a relação entre os padrões de estruturação populacional em Necromys lasiurus e N. lenguarum e as irrupções populacionais localmente conhecidas ratadas. 1.1.1 Objetivos específicos Padronizar a amplificação e testar a utilidade de locos heterologos de microssatélites para estudos populacionais nas espécies de Necromys e outros akodontinos; Ampliar a amostragem geográfica de Necromys no território brasileiro analisando amostras do Brasil Central por meio de sequencias do gene mitocondrial citocromo b e marcadores nucleares tais como álcool desidrogenase e intron-7 do beta-fibrinogênio; Examinar os padrões de variação genética em N. lasiurus e N. lenguarum, medidos por meio de sequencias dos marcadores acima citados e da genotipagem de microssatélites, comparando-os entre as duas espécies e com àqueles relacionados com outras espécies envolvidas ou não em ratadas; Investigar os fatores envolvidos na origem e manutenção dos padrões revelados; 1.2. Referências Bibliográficas 8 Almeida, F.C.; Maroja, L.S.; Seuánez, H.N.; Cerqueira, R. & Moreira, M.A.M. 2000. Identification of microsatellite loci in the water-rat Nectomys squamipes (Rodentia Sigmodontinae). Molecular Ecology, 9: 2172–2173. Aplin, K.P. & Lalsiamliana, J. 2010. Chronicle and impacts of the 2005-09 mautam in Mizoram. Pp. 13–48. In: Singleton, G.; Belmain, S.; Brown, P. & Hardy, B. (Eds.) Rodent Outbreaks: Ecology and Impacts. Los Baños (Philippines), International Rice Research Institute. Berthier, K.; Charbonnel, N.; Galan, M.; Chaval, Y. & Cosson, J-F. 2006. Migration and recovery of the genetic diversity during the increasing density phase in cyclic vole populations. Molecular Ecology, 15; 2665–2676. Berthier, K.; Galan, M.; Foltête, J-C.; Charbonnel, N. & Cosson, J-F. 2005. Genetic structure of the cyclic fossorial water vole (Arvicola terrestris): Landscape and demographic influences. Molecular Ecology, 14: 2861–2871. Bonvicino, C.R.; Oliveira, J.A. & D´Ándrea, P.S. 2008. Guia dos Roedores do Brasil com chaves para gêneros baseadas em caracteres externos. Rio de Janeiro, Centro Pan- Americano de Febre Aftosa-OPAS/OMS, 120 pp.. Chapuis, M-P; Lecoq, M.; Michalakis, Y.; Loiseau, A.; Sword, G.A.; Piry, S. & Estoup, A. 2008. Do outbreaks affect genetic population structure? A worldwide survey in Locusta migratoria, a pest plagued by microsatellite null alleles. Molecular Ecology, 17: 3640– 3653. Chapuis, M-P; Loiseau, A.; Michalakis, Y.; Sword, G.A.; Lecoq, M.; Franc, A. & Estoup, A. 2009.Outbreaks, gene flow and effective population size in the migratory locust, Locusta migratoria: a regional-scale comparative survey. Molecular Ecology, 18: 792–800. Chapuis, M-P; Popple, J.A.M.; Berthier, K.; Simpson, S.J.; Deveson, E.; Spurgin, P.; Steinbauer, M.J & Sword, G.A. 2011.Challenges to assessing connectivity between massive populations of the Australian plague locust. Proceedings of the Royal Society of London B, 278 (1721): 3152–3160. Chiappero, M.B.; Gardenal, C.N. & Panzetta-Dutari, G.M. 2005. Isolation and characterization of microsatellite markers in Calomys musculinus (Muridae, Sigmodontinae, Phyllotini), the natural reservoir of Junin virus. Molecular Ecology Notes, 5: 593–595. Chiappero, M.B.; Panzetta-Dutari, G.M.; Gómez, D.; Castillo, E.; Polop, J.J. & Gardenal, C.N. 2011. Contrasting genetic structure of urban and rural populations of the wild rodent Calomys musculinus (Cricetidae, Sigmodontinae). Mammalian Biology, 76: 41–50. Costello, A.B; Down, T.E.; Pollard, S.M.; Pacas, C.J. & Taylor, E.B. 2003. The influence of history and contemporary stream hydrology on the evolution of genetic diversity within 9 species: an examination of microsatellite DNA variation in bull trout, Salvelinus confluentus (Pisces: salmonidae). Evolution, 57: 328–244. Cullingham, C.I.; Pond, B.A: Kyle, C.J.; Rees, E.E.; Rosatte, R.C. & White, B.N. 2008. Combining direct and indirect genetic methods to estimate dispersal for informing wildlife disease management decisions. Molecular Ecology, 17: 4874–4886. D’Elia, G.; Pardiñas, U.F.J.; Jayat, J.P. & Salazar-Bravo, J. 2008. Systematics of Necromys (Rodentia, Cricetidae,Sigmodontinae): species limits and groups, with comments on historical biogeography. Journal of Mammalogy, 89(3): 778–790. Deter, J.; Chaval, Y.; Galan, M.; Gauffre, B.; Morand, S.; Henttonen, H.; Laakkonen, J.; Voutilainen, L.; Charbonnel, N. & Cosson, J.F. 2008. Hinship, dispersal and hantavirus transmission in bank and common voles. Archives of Virology, 153: 435–444. Dong, J.; Li, C. & Zhang, Z. 2010. Density-dependent genetic variation in dynamic populations of the greater long-tailed hamster (Tscherskia triton). Journal of Mammalogy, 91(1): 200–207. Ehrich, D. & Jorde, E. 2005. High genetic variability despite high-amplitude population cycles in lemmings. Journal of Mammalogy, 86: 380–385. Gallardo, M. & Mercado, C. 1999. Mast seeding of bamboo shrubs and mouse outbreaks in southern Chile. Mastozoologia Neotropical, 6: 103–111. Garza, J.C.; Dallas, J.; Duryadi, D.; Gerasimov, S.; Croset, H. & Boursot, P. 1997. Social structure of the mound-building mouse Mus spicilegus revealed by genetic analysis with microsatellites. Molecular Ecology, 6:1009–1017. González, L.A.; Murúa, R. & Jofré, C. 2000. Habitat utilization of two muroid species in relation to population outbreaks in southern temperate forests of Chile. Revista Chilena de Historia Natural, 73: 489–495. González-Ittig, R.; Salazar-Bravo, J.; Polop, J. & Gardenal, C.N. 2008. Isolation and characterization of microsatellite markers in Oligoryzomys longicaudatus (Muridae, sigmodontinae, Oryzomyini), the natural reservoir of genotype Andes hantavirus. Molecular Ecology Resources, 8: 1466–1468. González-Ittig, R.E.; Rossi-Fraire, H.J.; Cantoni, G.E.; Herrero, E.R.; Benedetti, R.; Gallardo, M.H. & Gardenal, C.N. 2010. Population genetic structure of long-tailed pygmy rice rats (Oligoryzomys longicaudatus) from Argentina and Chile based on the mitochondrialcontrol region. Canadian Journal of Zoology, 88: 23–35. Guivier, E.; Galan, M.; Chaval, Y.; Xuéreb, A.; Salvador, A.R.; Poulle, M.L.; Voutilainen, L.; Henttonen, H.; Charbonnel, N. & Cosson, J.F. 2011. Landscape genetics highlights the role of bank vole metapopulation dynamics in the epidemiology of Puumala hantavirus. Molecular Ecology, 20, 17, 3569-3583. 10 Harrison S (1997) Persistent, localized outbreaks in the western tussock moth (Orgyia vetusta): the roles of resources, predation and poor dispersal. Ecological Entomology, 22: 158–166. Jaksic, F.M. & Lima, M. 2003. Myths and facts on ratadas: bamboo blooms, rainfall peaks and rodent outbreaks in South America. Austral Ecology, 28: 237–251. Jarne, P. & Lagoda, P.J.L. 1996. Microsatellites from molecules to populations and back. Trends in Ecology and Evolution, 11: 424–429. Johnson, M.S. & Black, R. 1995. Neighbourhood size and the importance of barriers to gene flow in an intertidal snail. Heredity, 45: 142–154. Lara, M.C.; Geise, L. & Schneider, C.J. 2005. Diversification of small mammals in the Atlantic Forest of Brazil. Pp. 311–353. In: Lacey, E.A. & Myers, P., (Eds). Mammalian Diversification: From Chromosomes to Phylogeography (a celebration of the career of James L. Patton). Berkeley, University of California Press. Libardi, G.S. & Percequillo, A.R. 2008. Variação geográfica e não-geográfica de Euryoryzomys russatus (Rodentia: Sigmodontinae). In: Anais da XVI Simposio Internacional de Iniciação Científica. São Paulo, Universidade de São Paulo. Lima, M.P.; Marquet, A. & Jaksic, F.M. 1999. El Niño events, precipitation patterns, and rodent outbreaks are statistically associated in semiarid Chile. Nordic Society Oikos, 22(2): 213-218 Lovett, G.M.; Christenson, L.M.; Groffman, P.M.; Jones, C.G.; Hart, J.E. & Mitchell, M.J. 2002. Insect defoliation and nitrogen cycling in forests Bioscience, 52(4): 335–341. Macêdo, R.H. & Mares, M.A. 1987. Geographic variation in the south american cricetine rodent Bolomys lasiurus. Journal of Mammalogy, 68(3): 578–594. Maroja, L.S.; Almeida, F.C.; Cerqueira, R.; Seuánez, H.N. & Moreira, M.A.M. 2003. Nectomys squamipes microsatellites and homologous loci in sigmodontine rodents. Journal of Heredity, 94(2): 171–174. Miranda, G.B.; Andrades-Miranda, J.; Oliveira, L.F.B.; Langguth, A. & Mattevi, M.S. 2007. Geographic patterns of genetic variation and conservation consequences in three south American rodents. Biochemical Genetics, 45: 839–856. Neigel, J.E. 1997. A comparison of alternative strategies for estimating gene flow from genetic markers. Annual Review of Ecology and Systematics, 28: 105–128. Palma, R.E.; Cancino, R.A. & Rodríguez-Serrano, E. 2010. Molecular systematics of Abrothrix longipilis (Rodentia: Cricetidae: Sigmodontinae) in Chile. Journal of Mammalogy, 91(5): 1102–1111. 11 Palma, R.E.; Rivera-Milla, E.; Salazar-Bravo, J.; Torres-Pérez, F.; Pardiñas, U.F.J.; Marquet, P.A.; Spotorno, A.E.; Meynard, A.P. & Yates, T.L. 2005. Phylogeography of Oligoryzomys longicaudatus (Rodentia: Sigmodontinae) in temperate South America. Journal of Mammalogy 86: 191–200. Pardiñas, U.F.J.; D’Elía, G. & Ortiz, P.E. 2002. Sigmodontinos fósiles (Rodentia, Muroidea, Sigmodontinae) de América del Sur: estado actual de su conocimiento y prospectiva. Mastozoologia Neotropical, 9(2): 209–252. Pearson, O.P. 2002. A perplexing outbreak of mice in Patagonia, Argentina. Studies on Neotropical Fauna and Environment, 37: 187–200. Ronnàs, C.; Cassel-Lundhagen, A.; Battisti, A.; Wallen, J. & Larsson, S. 2011. Limited emigration from an outbreak of a forest pest insect. Molecular Ecology, 20: 4606–4617. Sage, R.D.; Pearson, O.P.; Sanguinetti, J. & Pearson, A.K. 2007. Ratada 2001: a rodent outbreak following the flowering of bamboo (Chusquea culeou) in southern Argentina. Pp. 177–224 In: Kelt, D.A.; Lessa, E.P.; Salazar-Bravo, J. & Patton, J.L. (Eds.). The quintessential naturalist: honoring the life and legacy of Oliver P. Pearson. Berkeley, University of California Press. Singleton, G.; Belmain, S.; Brown, P. & Hardy, B. (Eds.). 2010. Rodent Outbreaks: Ecology and Impacts. Los Baños (Philippines), International Rice Research Institute, 289 p. Slatkin, M. 1985. Gene flow in natural populations. Annual Review of Ecology and Systematics. 16: 393–430. Slatkin, M. 1987. Gene flow and the geographic structure of natural populations. Science, 236: 787–792. Ventura, K..; Silva, M.J.J.; Fagundes, V.; Pardini, R. & Yonenaga-Yassuda, Y. 2004. An undescribed karyotype for Thaptomys (2n = 50) and the mechanism of differentiation from Thaptomys nigrita (2n = 52) evidenced by FISH and Ag–NORs. Caryologia, 57: 89–97. Ventura, K.; Silva, M.J.J. & Yonenaga-Yassuda, Y. 2010. Thaptomys Thomas 1915 (Rodentia, Sigmodontinae, Akodontini) with karyotypes 2n=50, FN=48 and 2n=52, FN=52: Two monophyletic lineages recovered by molecular phylogeny. Genetics and Molecular Biology, 33(2): 256–261. Vera, N.S.; Chiappero, M.B.; Priotto, J.W. & Gardenal, C.N. 2011. Isolation of microsatellite loci in Akodon azarae (Muridae,Sigmodontinae) and cross-amplification in other Akodontini species. Journal of Genetics, 90(1): 25–29. Vessey, S.H. & Vessey, K.B. 2007. Linking behavior, life history and food supply with the population dynamics of white-footed mice (Peromyscus leucopus). Integrative Zoology. 2: 123–130. 12 Capítulo 1 Artigo publicado no Boletim da Sociedade Brasileira de Mastozoologia, 71, Isolamento de locos de microssatélites em Akodon cursor (Cricetidae, Sigmodontinae) e amplificação cruzada em outros roedores akodontinos Isolation of polymorphic microsatellite loci in Akodon cursor (Cricetidae, Sigmodontinae) and cross-amplification in other akodontine rodents 13 Isolamento de locos de microssatélites em Akodon cursor (Cricetidae, Sigmodontinae) e amplificação cruzada em outros roedores akodontinos Isolation of polymorphic microsatellite loci in Akodon cursor (Cricetidae, Sigmodontinae) and cross-amplification in other akodontine rodents Título abreviado: Novel polymorphic microsatellite loci in Akodon cursor Jânio C. Moreira1,2,3, Ana Beatriz A. da Cunha4,5,6, Miguel A. M. Moreira5, João A. de Oliveira1,2, Cibele R. Bonvicino5, Rui Cerqueira6 1 Setor de Mastozoologia, Departamento de Vertebrados, Museu Nacional/UFRJ, Quinta da Boa Vista s/n,São Cristovão, Rio de Janeiro, RJ, Brazil, CEP 20940-040, 2 Programa de Pós-Graduação em Biodiversidade e Biologia Evolutiva, UFRJ, Ilha do Fundão, Cidade Universitária, Rio de Janeiro, RJ, Brazil 3 Corresponding author: e-mail: janiomoreira@gmail.com 4 Programa de Pós-Graduação em Ciências Biológicas (Genética), UFRJ, Ilha do Fundão, Cidade Universitária, Rio de Janeiro, RJ, Brazil 5 Programa de Genética, Instituto Nacional de Câncer, Rio de Janeiro, RJ, Brazil 6 Laboratório de Vertebrados, Departamento de Ecologia, IB, CCS, Universidade Federal do Rio de Janeiro, Ilha do Fundão, Rio de Janeiro, RJ, Brazil Resumo (até 100 palavras) Oito novos locos de microssatélites foram isolados para Akodon cursor, tendo sido testada a amplificação cruzada em Akodon serrensis, Necromys lasiurus e Thaptomys nigrita. A espécie foco 14 desse estudo apresentou um número de alelos por loco variando de 2 a 20 e valores de heterozigosidades observada (0,1–1) e esperada (0,1 – 0,94) similares. O número de locos com amplificação cruzada bem sucedida variou de 4 (A. serrensis) a 7 (N. lasiurus). Os elevados níveis de polimorfismo reportados sugerem a utilidade dos marcadores testados para estudos futuros de estrutura populacional e genética da paisagem em todas as espécies estudadas. Palavras chave: genética da paisagem, microssatelites, amplificação heteróloga, Sigmodontinae, Mata Atlântica. Abstract (100 words) We characterized 8 novel polymorphic microsatellite markers for Akodoncursor, and tested their cross-amplification in Akodon serrensis, Necromys lasiurus and Thaptomys nigrita. The focal species displayed a number of alleles per locus varying from 2 to 20, and observed and expected heterozygosities ranging from 0.1 to 1 and from 0.1 to 0.94, respectively. The number of successfully cross-amplified markers varied from 4 (A. serrensis) to 7 (N. lasiurus). The high levels of polymorphism found suggest that these markers are potentially useful for future studies of population structure and landscape genetic studies in all tested species. Key words: landscape genetics, microsatellite, cross-amplification, Sigmodontinae, Atlantic Forest. Akodon cursor (Winge, 1887) is one of the most common species in the Sigmodontinae assemblages inhabiting the Atlantic Rainforest in eastern Brazil between latitudes 8⁰S and 26⁰S (Geise, 2012). Its wide distribution encompasses both natural environments and areas with different levels of anthropogenic influence (Bonvicino et al., 2008). This environmental heterogeneity is reflected in high levels of both chromosomal (Fagundes et al., 1998) and molecular polymorphisms (Geise et al., 2001, 2007; Nogueira & Fagundes, 2008), characteristics shared by other species in the genus (Coyner et al., 2013). Interestingly, geographic analyses in Akodon cursor have disclosed 15 a marked incongruence among morphological, chromosomal, and molecular data (Geise, 2012). While morphological and chromosomal data reveal a lack of geographic structure (Geise et al., 2007), molecular analyses employing mitochondrial markers delineated two geographically distinct groups of haplotypes: a northern clade comprising samples from northeastern Brazil and a southern clade composed of specimens from southeastern Brazil (Nogueira & Fagundes, 2008). Although mitochondrial markers proved useful in revealing the existence of these two haplogroups in Akodon cursor, they were not sufficiently variable to resolve, for example, the relationships among populations within these groups. The use of highly variable microsatellite nuclear markers in fine-scale spatial genetic studies can provide valuable insights into the role of factors such as geographic barriers (Nogueira & Fagundes, 2008), geographic distance (Colombi et al., 2010; Yazbeck et al., 2011), habitat fragmentation, population dynamics, demography and vagility in shaping the patterns of genetic diversity of a species (Freeland et al., 2011). For this purpose, we here characterize eight polymorphic microsatellite loci isolated from A. cursor, and report the results of cross-species amplification tests carried out in three other Akodontini: Akodon serrensis Thomas 1902, Necromys lasiurus (Lund, 1841) and Thaptomys nigrita (Lichtenstein, 1829). We extracted genomic DNA for library construction and genotyping from ethanol-preserved liver tissue using the standard proteinase-K/phenol-chloroform protocol (Sambrook & Russell, 2000). Microsatellite loci were isolated from an enriched genomic library following the protocols described in Almeida et al. (2000) and Maroja et al. (2003). Briefly, a high-quality genomic DNA sample (10µg) from a single A. cursor specimen was digested with AluI (New England Biolabs); size-selected fragments (ranging from 200 to 600 bp) were then excised from agarose gel and linked into SmaI-digested, dephosphorylated pUC18 and transferred to E. coli DH5 competent cells. DNA from recombinant colonies was transferred to nylon membranes (NEN) and hybridized to 16 [γ32P]-ATP labeled (GT)10, (CT)10, (AGG)7, (GAA)7 and (GATA)5 oligonucleotide-probes. We isolated plasmids from 45 positive colonies by the miniprep alkaline-lysis procedure (Sambrook & Russell, 2000). Inserts were amplified by polymerase chain reaction (PCR) using M13 universal primers (Forward: 5’GTAAAACGACGGCCAGT3’ and Reverse: 5’CCCAGTCACGTTGTAAAACG3’) following a pre-denaturation step at 94°C for 2 min, and 35 cycles at 94°C for 30 sec, 55°C for 30 sec and 72°C for 30 sec, with a final extension of 72°C for 10 min. PCR was carried out with 1U of Tth DNA Polymerase (Biotools), 100ng of DNA template, 5l of 10X PCR Buffer (75 mM Tris-HCl, 2.0 mM MgCl2, 50 mM KCl, 20 mM (NH4)SO4), 10 picomoles of each M13 primer and 0.3mM of each dNTP in a final volume of 50 l. Amplicons were purified with GFX™ PCR DNA and Gel Band Purification kit (GE Healthcare), labeled with Big Dye™ Terminator Cycle Kit (Applied Biosystems) and sequenced in both directions using an ABI Prism 377 automated sequencer. Sequences from thirteen different plasmids were selected for the design of primers flanking the microsatellite regions using the program Primer3 (Rozen & Skaletsky, 2000). To optimize amplification conditions, PCR was performed in final volumes of 15µl with approximately 40 ng of genomic DNA, 1.5µl of 10X PCR Buffer (75 mMTris–HCl, 2.0 mM MgCl2, 50 mM KCl, 20 mM (NH4)SO4), 6–10 pmol of each primer, 300µmol of each dNTP, and 0.5U of Tth DNA Polymerase (Biotools),with an initial denaturation step of 3 min at 94⁰C followed by 30–35 cycles of 30 sec at 94⁰C, 30 sec at the specific annealing temperatures for primer pairs [Ta⁰C, see Table 1], 30 sec at 72⁰C, and a final extension period of 4–7 min at 72⁰C. Eight primer pairs (Table 1) produced good quality amplification patterns and were evaluated in 30 A. cursor specimens from a natural population from southeastern Brazil (Guapimirim, Rio de Janeiro: 22⁰02'S, 42⁰59'W). For this step, we labeled the forward primer with a 6-FAM fluorescent dye. These primer sets were also tested for amplification in three other akodontine species (Table 2): Akodon serrensis, Necromys lasiurus and Thaptomys nigrita. We 17 separated and electrophoresed Amplicons on a Megabace 1000 automated sequencer (GE Healthcare) using ET400-ROX size standard. We carried out allele sizing and genotype confirmation in Genetic Profiler v.2.2 (GE Healthcare). To calculate observed and expected heterozygosities we used Cervus 3.0.3 (Kalinowski et al., 2007), and checked for the presence of null alleles with the program Microchecker (van Oosterhout et al., 2004); deviations from Hardy- Weinberg and linkage equilibrium between loci were tested with GENEPOP 4.2 (Raymond & Rousset, 1995). To control for the false discovery rate (type I error) we adjusted the significance criteria for all multiple comparisons by using the Bonferroni correction (Rice, 1989). Thus, only loci showing significant p-values after correction are highlighted in the results paragraphs and in table 2. Genotyping of the eight microsatellite loci in 30 individuals of Akodon cursor (Table 2) revealed an average of 14.25 alleles per locus with a minimum of 2 (AkH1) and a maximum of 20 (AkC1), totaling 114 alleles. Values for the observed (Ho) and expected (He) heterozygosities ranged from 0.1 to 1 and from 0.1 to 0.94, respectively. The polymorphism information content (PIC) per locus ranged from 0.09 (AkH1) to 0.92 (AkC1), with an average of 0.795. PIC is an index of the potential locus suitability of a given molecular marker in population genetics studies (Botstein et al., 1980). The most useful markers are those with PIC values higher than 0.5 (Souza et al., 2012; Mishra et al., 2014). With PIC values exceeding 0.85, seven of the eight tested loci met this condition while locus AkH1 was considered slightly informative (PIC<0.25). None of the 8 loci departed significantly from Hardy-Weinberg equilibrium but significant linkage disequilibrium was found between both AkJ1/AkL1 (p=0) and AkJ1/AkPQAc1 (p=0.0002), even after Bonferroni correction (adjusted alpha=0.0008). In addition, Micro-checker analyses failed to reveal any evidence of scoring errors, large allele dropout, or the presence of null alleles for any loci. Together, these results suggest that, with the exception ofAkH1, the new loci described here are highly polymorphic (Table 2) and extremely promising for evaluating the genetic variability of the studied 18 species. Nevertheless, given that these results are based on the analysis of a single population, their potential should be further tested in a more detailed population study, which should include larger sample sizes and additional populations. Such an investigation could also clarify if the linkage disequilibrium reported here is due to null alleles or to demographic factors such as inbreeding, bottlenecks, or immigration (Sabatti & Risch, 2002; Falush et al., 2007; Bucher et al., 2009). Interestingly, the high levels of heterozygosis and polymorphism at the microsatellite loci herein described are similar to those reported for other sigmodontine rodents such as Nectomys squamipes (mean Ho=0.704 - Almeida et al., 2000; Maroja et al., 2003), Calomys musculinus (mean Ho=0.525 - Chiappero et al., 2005), Akodon azarae (mean Ho=0.664 - Vera et al., 2011), and Oligoryzomys longicaudatus (mean Ho=0.635 - Gonzalez-Ittig et al., 2008). Results of cross-amplification analyses, detailed in Table 2, were similar to those observed in Akodon cursor, with highly polymorphic loci. A single locus, AkH1, failed to amplify in the three species tested. Cross-amplification proceeded best in Necromys lasiurus (7 loci), followed by Thaptomys nigrita (6) and Akodon serrensis (4). In these species, amplified loci exhibited values of Ho and He exceeding 0.78, and PIC values ranging from 0.7 (A. serrensis) to 0.93 (N. lasiurus and T. nigrita). There was no significant deviation from Hardy-Weinberg equilibrium but significant linkage disequilibrium was found between AkJ1/AkL1 in both Necromys lasiurus (p=0.00069; adjusted α=0.0011) and Thaptomys nigrita (p=0.0004; adjusted α=0.0017). The successful transferability evidenced by such results points to these novel markers as promising tools for future population genetics and molecular ecology studies investigating dispersal patterns, genetic connectivity among populations, social structure and population dynamics in Akodon cursor and closely related species. Because some of these species (e.g., Necromys lasiurus) are associated with Hantaviruses and plague, such studies could provide a better understanding of 19 the role of genetic diversity in susceptibility for these zoonoses, thus contributing to improved management, epidemiological surveillance, and prevention strategies. Acknowledgments: Original conception and experiments to isolate loci, design primers and optimize amplification in Akodon cursor took place during the development of a MS dissertation by A.B.A. da Cunha in the Genetics Graduate Program of the Federal University of Rio de Janeiro (UFRJ). Development of cross-amplification experiments in Akodon serrensis, Necromys lasiurus, and Thaptomys nigrita is part of the DS requirements of J.C. Moreira at the Biodiversity and Evolutionary Biology Graduate Program of the UFRJ. We are indebted to Dr. Hector Seuanez for providing laboratory facilities. We are also grateful to K. Lobo, L. Monnerat, K. Moura and C. Furtado for assistance during the genotyping procedure. F. Pedone, S. Amaro, C. Furtado and F. Knackfuss helped with valuable suggestions during PCR optimization and the statistical analyses. Two anonymous referees thoroughly reviewed the submitted manuscript providing valuable comments that greatly improved the quality of this manuscript. Special thanks are due to Christopher J. Tribe for revising the English grammar and structure of the final version. Financial support was provided by CAPES (RC), CNPq (CRB, JAO, MAMM, RC), FAPERJ (CRB, JAO – process number E26/111.720/2012), PPBio/CNPq/Rede BioM.A, and PROBIO II/MCT/MMA/GEF (RC). JCM benefited from a doctoral scholarship from CAPES and ABAC benefited from a MS fellowship from CNPq. References: Almeida FC, Maroja LS, Seuánez HN, Cerqueira R, Moreira MAM. 2000. Identification of microsatellite loci in the water-rat Nectomys squamipes (Rodentia Sigmodontinae). Molecular Ecology 9(12): 2172–2173. Bonvicino CR, Oliveira JA, D´Ándrea PS. 2008. Guia dos Roedores do Brasil com chaves para gêneros baseadas em caracteres externos. Centro Pan-Americano de Febre Aftosa-OPAS/OMS, Rio de Janeiro. 20 Botstein D, White RL, Skolnick M, Davis RW. 1980. Construction of a genetic linkage map in man using restriction fragment length polymorphisms. The American Journal of Human Genetics 32(3): 314–331. Bucher TB, Wandeler P, Hegelbach J, Keller LF. 2009. Development of microsatellite loci in the European Dipper, Cinclus cinclus. Conservation Genetics Resources, 1(1): 309–312 Chiappero MB, Gardenal CN, Panzetta-Dutari GM. 2005. Isolation and characterization of microsatellite markers in Calomys musculinus (Muridae, Sigmodontinae, Phyllotini), the natural reservoir of Junin virus. Molecular Ecology Notes 5(3): 593–595. http://dx.doi.org/10.1111/j.1471-8286.2005.01003.x Colombi VH, Lopes SR, Fagundes V. 2010. Testing the Rio Doce as a riverine barrier in shaping the Atlantic rainforest population divergence in the rodent Akodon cursor. Genetics and Molecular Biology 33(4): 785–789. http://dx.doi.org/10.1590/S1415-47572010000400029 Coyner BS, Braun JK, Mares MA, Van Den Bussche RA. 2013. Taxonomic validity of species groups in the genus Akodon (Rodentia, Cricetidae). Zoologica Scripta 42(4): 335–350. http://dx.doi.org/10.1111/zsc.12014 Fagundes V, Christoff AU. and Yonenaga-Yassuda Y. 1998. Extraordinary chromosomal polymorphism with 28 different karyotypes in the neotropical species Akodon cursor (Muridae, Sigmodontinae), one of the smallest diploid number in rodents (2n = 16, 15 and 14).-Hereditas, 129: 263–274. Falush D, Stephens M, Pritchard JK 2007. Inference of population structure using multilocus genotype data: dominant markers and null alleles. Molecular Ecology Notes, 7: 574–578. Freeland JR, Kirk H and Petersen S. 2011. Molecular Ecology, 2nd edition. John Wiley & Sons, Chichester, West Sussex, United Kingdom. Geise L. 2012. Akodon cursor (Rodentia: Cricetidae). Mammalian Species 44(1): 33–43. http://dx.doi.org/10.1644/893.1 Geise L, Smith MF, Patton JL. 2001. Diversification in the genus Akodon (Rodentia, Sigmodontinae) in southeastern South America: Mitochondrial DNA sequence analysis. Journal of Mammalogy 82(1): 92–101. http://dx.doi.org/10.1644/1545– 1542(2001)082<0092:DITGAR>2.0.CO;2 Geise L, Marroig G, Pereira LG. 2007. Comparative craniofacial morphometry, karyotypic and mtDNA in the Akodon cursor (Rodentia, Muridae) from the South American Atlantic Forest: integrative approaches. Journal of Morphology 268: 1076. González-Ittig R, Salazar-Bravo J, Polop J, Gardenal CN. 2008. Isolation and characterization of microsatellite markers in Oligoryzomys longicaudatus (Muridae, Sigmodontinae, Oryzomyini), the natural reservoir of genotype Andes hantavirus. Molecular Ecology Resources 8(6): 1466– 1468. http://dx.doi.org/10.1111/j.1755-0998.2008.02231.x 21 Kalinowski ST, Taper ML, Marshall TC. 2007. Revising how the computer program CERVUS accommodates genotyping error increases success in paternity assignment. Molecular Ecology 16(5): 1099–1006. http://dx.doi.org/10.1111/j.1365-294X.2007.03089.x Maroja LS, Almeida FC, Cerqueira R, Seuánez HN, Moreira MAM. 2003. Nectomys squamipes microsatellites and homologous loci in sigmodontine rodents. Journal of Heredity, 94(2): 171– 174. http://dx.doi.org/10.1093/jhered/esg017 Mishra S, Sharma R, Singh SK, Munjal AK, Goyal SP. 2014. A comparative study of the use of tiger-specific and heterologous microsatellite markers for population genetic studies of the Bengal tiger (Panthera tigris tigris). African Journal of Biotechnology 13 (8): 936–943. http://dx.doi.org/10.5897/AJB12.2977 Nogueira CDA, Fagundes V. 2008. Akodon cursor Winge, 1887(Rodentia, Sigmodontinae): One or two species? New evidences based on molecular data. Zootaxa 1768: 41–51. Raymond M, Rousset F. 1995. GENEPOP (version 1.2): population genetics software for exact tests and ecumenicism. Journal of Heredity 86(3): 248–249. Rice WR. 1989. Analyzing tables of statistical tests. Evolution, 43(1): 223–225. Rozen S, Skaletsky H. 2000. Primer3 on the WWW for general users and for biologist programmers. Pp. 365–386, in Krawetz S, Misener S (Eds.), Bioinformatics Methods and Protocols in the series Methods in Molecular Biology. Humana Press, Totowa, NJ. Sabatti C, Risch N. 2002: Homozygosity and linkage disequilibrium. Genetics, 160: 1707–1719. Sambrook J, Russell DW. 2000. Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. Souza ASMC, Mino CI, Lama SND. 2012. Polymorphic heterologous microsatellite loci for population genetics studies of the white-faced ibis Plegadis chihi (Vieillot, 1817) (Pelecaniformes, Threskiornithidae). Genetics and Molecular Biology 35(1): 74–80. http://dx.doi.org/10.1590/S1415-47572012005000018. Van Oosterhout C, Hutchinson WF, Wills DPM, Shipley P. 2004. MICRO-CHECKER: software for identifying and correcting genotyping errors in microsatellite data. Molecular Ecology Notes 4(3): 535–538. http://dx.doi.org/10.1111/j.1471-8286.2004.00684.x Vera NS, Chiappero MB, Priotto JW, Gardenal CN. 2011. Isolation of microsatellite loci in Akodon azarae (Muridae, Sigmodontinae) and cross-amplification in other Akodontini species. Journal of Genetics, 90(1): 25–29. http://www.ias.ac.in/jgenet/OnlineResources/90/e25.pdf Yazbeck GM, Brandão RL, Cunha HM, Paglia AP. 2011. Detection of two morphologically cryptic species from the cursor complex (Akodon spp; Rodentia, Cricetidae) through the use of RAPD markers. Genetics and Molecular Research 10 (4): 2881–2892. http://dx.doi.org/10.4238/2011.November.22.2 22 Table 1. Characteristics of the seven polymorphic microsatellite markers isolated in Akodon cursor. Ta Ak= annealing temperature in Akodon cursor, Ta het = heterologous annealing temperature, NC= number of cycles. Primer (5’ → 3’) Motif Ta Ak (⁰C) Ta het (⁰C) NC Allele Size Range AkC1 F-GCCAAAGTCTGCAAGCAA R-CTTTCTTAAGGCTTGTGGCC (CA)6(GA)29 55 55 35 225-303 AkH1 F-GAGATTTAGTTTGGATGACCG R-GATGTTTTCCTTGGATTCC (CA)6 58 58 30 230-234 AkJ1 F-GTATGGGTCCAACCTAACTTG R-CAGGATTGAACTCAGTTTCTC (CA)28 55 55 35 131-167 AkL1 F- GTAGTGGGTCCAACCTAACTTG R-CATACTTGTAAGGGAAGCGTC (CA)15(17) 58 58 30 111-147 AkLi1.2 F-CACCGCCCTGCTTTTATTTA R-ACAAAAAGGTGGTGGTGCAT (TAAA)4 and (TC)7 60 61 35 195-253 AkPQAc 1 F-AGGTACCCGCAACTCTTACA R-GGCAAGTTCTAAGCCAACGA (TG)23 63 45 30 188-252 AkPQAs 1 F-CTCCTGCCCTGTGTTTATCA R-CTTGAAGGGCTTCCAGACAC (CA)24 60 60 35 164-214 AkPQT1 F-GGGAAAGCACGACAACTGAT R-TTCCTCTTTCCCCTTCCTGT (GT)24 and (CA)4 65 60 30 191-235 23 Table 2. Results of genotyping in Akodon cursor showing which loci worked best and were polymorphic in cross-amplification tests in three other akodontine species. N=sample size, Na=observed number of alleles, Ho=observed heterozygosity, He=expected heterozygosity, p=p value for Hardy-Weinberg Equilibrium, PIC=polymorphism information content. Cells with dashes (-) denote amplification failure. Significant linkage disequilibrium: a and b: Akodon cursor (corrected α=0.05/56=0.0008) - aAkJ1 & AkL1(p=0), b AkJ1 & AKPQAc1(p=0.0002); c: Necromys lasiurus (corrected α=0.05/42=0.0011) - cAkJ1 & AkL1(p=0.00069); and d: Thaptomys nigrita (corrected α=0.05/30=0.0017) - dAkJ1 & AkL1(p=0.0004). Cross-amplification experiments Akodon cursor Necromys lasiurus Thaptomys nigrita Akodon serrensis Na Ho He PIC p N Na Ho He PIC p N Na Ho He PIC p N Na Ho He PIC p AkC1 20 0.97 0.94 0.92 0.84 27 19 1.00 0.95 0.93 0.55 - - - - - - 15 10 1.00 0.88 0.84 0.67 AkH1 2 0.10 0.10 0.09 0.77 - - - - - - - - - - - - - - - - - - AkJ1a,b,c,d 18 0.97 0.93 0.91 0.78 26 20 0.96 0.94 0.92 0.77 23 17 0.91 0.93 0.90 0.31 11 10 1.00 0.90 0.84 0.34 AkL1a,c,d 17 0.97 0.91 0.89 0.80 19 16 1.00 0.93 0.93 0.04 21 11 1.00 0.89 0.85 0.52 2 4 1.00 1.00 0.70 1.00 AkLi1.2 16 1 0.92 0.90 0.93 18 18 0.94 0.95 0.91 0.80 18 21 1.00 0.96 0.93 1.00 18 8 0.89 0.84 0.79 0.14 AkPQAc1b 13 0.97 0.91 0.89 0.45 13 13 0.78 0.92 0.89 0.14 21 14 0.99 0.89 0.86 0.12 - - - - - - AkPQAs1 17 0.96 0.94 0.91 0.18 27 16 1.00 0.93 0.90 0.66 19 14 1.00 0.86 0.82 0.31 - - - - - - AkPQT1 11 1 0.88 0.85 0.29 23 16 0.96 0.92 0.89 0.71 26 12 0.85 0.87 0.84 0.59 - - - - - - Mean 14.25 0.87 0.82 0.80 16.86 0.95 0.93 0.91 14.83 0.96 0.90 0.87 8.00 0.97 0.90 0.79 24 Capítulo 2 Artigo a ser submetido ao periódico Journal of Biogeography Pleistocene climate changes and the diversification of lowland species of the rodent genus Necromys in South American Dry Diagonal formations 25 ORIGINAL ARTICLE Pleistocene climate changes and the diversification of lowland species of the rodent genus Necromys in South American Dry Diagonal formations Jânio C. Moreira1,2, Júlio F. Vilela3, Fabrícia F. Nascimento4, Alexandra Bezerra5, Cibele R. Bonvicino5 & João A. de Oliveira1,2,6 1. Programa de Pós-Graduação em Biodiversidade e Biologia Evolutiva, Universidade Federal do Rio de Janeiro, Ilha do Fundão, Cidade Universitária, Rio de Janeiro, RJ, Brazil 2. Setor de Mastozoologia, Departamento de Vertebrados, Museu Nacional/UFRJ, Quinta da Boa Vista s/n, São Cristovão, Rio de Janeiro, RJ, Brazil, CEP 20940- 040 3. Laboratório de Biologia Evolutiva Teórica e Aplicada, Departamento de Genética – Instituto de Biologia – CCS, UFRJ, Bloco A, Sala A2-095, Rua Prof. Rodolpho Paulo Rocco, S/N, Cidade Universitária, CEP: 21941-617, Rio de Janeiro, RJ, Brazil. 4. Department of Zoology, University of Oxford, South Parks Road, OX1 3PS, United Kingdom 5. Laboratório de Biologia e Parasitologia de Mamíferos Reservatórios Silvestres, Instituto Oswaldo Cruz, Fiocruz, 21045-900, Rio de Janeiro, RJ, Brazil, 6. Corresponding author: jaoliv@mn.ufrj.br 26 ABSTRACT Aim: We analyzed phylogeographic patterns in the widely distributed sigmodontine rodent Necromys lasiurus and its closest relative N. lenguarum to unveil the relative role of climate-driven environmental shifts in shaping the diversification processes in the South American diagonal of open vegetation formations. Location: Open South American vegetation formations: Chaco, Cerrado and Caatinga. Methods: We used a comparative phylogeographic approach to understand the biogeographical and demographic history of N. lasiurus and N. lenguarum. Mitochondrial and nuclear data of a a widespread sampling were analyzed by phylogenetics, networks and statistical tests. A molecular clock was used to obtain divergence time estimates. Finally, demographic changes were assessed by neutrality tests and mismatch distributions. Results: Molecular analyses revealed N. lenguarum as a genetically non-structured species under fast recent demographic expansion. In contrast, N. lasiurus is structured in five geographical groups highly coincident with phytogeographic provinces of Cerrado and Caatinga and putatively long-term climate stable areas in the diagonal of dry formations. Molecular dating suggested that both the divergence between N. lasiurus and N. lenguarum as well as their main intraspecific demographic processes took place during the Pleistocene coinciding with periods of climate-driven environmental shifts. Main conclusions: Regional singularities in the Pleistocene climate dynamics and species-specific differences on ecological features presumably caused N. lenguarum and N. lasiurus to develop distinct phylogeographic patterns. A key intrinsic feature to understand these differences is the large density fluctuationstermed as "ratadas" which would maintain large effective population sizes and high genetic diversity in N. 27 lasiurus. These findings underscore the role of the Pleistocene oscillating climates in shaping and originating diversity in Neotropics. Our results have also implication on public health policies, as N. lasiurus is implied as one of the most relevant reservoir of diseases, such as bubonic plague and hantaviruses. Keywords Comparative phylogeography, Dry Diagonal, Neotropical Region, widely distributed species, climate change, Pleistocene Refugia, secondary contact, rodent outbreaks, public health, bubonic plague. Introduction Pleistocene climate cycles profoundly altered the spatial distribution of vegetation formations worldwide by repeatedly subjecting them to expansion- fragmentation events (Bryja et al., 2014; Lanier et al., 2015). During these episodes, many species have expanded their ranges while others were confined to more stable areas (refugia) and rapidly (re)colonized suitable habitats after glacial retreat (Hewitt, 2004). Together with fossil, palynological, and climatic data, phylogeographical studies can help to clarify whether their current genetic structuring patterns represent a legacy of the Pleistocene (Avise, 2000). Despite this relevance, such assessments are still scarce in the highly diverse biomes of the Neotropics, preventing a better understanding of the evolutionary history of their biota (Beheregaray, 2008). In South America, this is particularly true for the Dry Diagonal (“DD”) (Prado & Gibbs, 1993), a diagonal belt of seasonally drought-stressed vegetation formations comprising the Cerrado, the Caatinga and the Chaco (Werneck, 2011). These formations separate the Amazon and Atlantic 28 forests and currently occupy, altogether, an area larger than that encompassed by these forest environments (Werneck, 2011). Despite their relevance, the DD vegetation formations remain understudied in relation to the Amazon or Atlantic Forest (Santos et al., 2014). Vegetation formations composing the DD share features such as a remarkable environmental heterogeneity, and xeric-adapted vegetations distributed in a complex mosaic pattern, but are distinguished by particular characteristics (Furley & Metcalfe, 2007; Werneck, 2011). The Cerrado is the second largest biome in South America covering an area of approximately 2 million km2, which includes diverse climatic, topographic and edaphic conditions (Werneck et al., 2011, 2012a). Its environmental heterogeneity results in a quite variable phytophysiognomy with a singular fire-tolerant grass layer, which includes open grasslands, woodlands and forests (Eiten, 1972; Oliveira & Marquis, 2002). Phytogeographic studies reveal both east-west and north-south disjunctions in Cerrado, supporting the division of this vegetation formation in four or five phytogeographic provinces (Ratter et al., 2003; Durigan, 2006). The climate is nowadays markedly seasonal with well-defined dry and wet periods (Felfini et al., 2005). However, both palynological (Ledru et al., 2006) and paleodistribution modeling evidence (Werneck et al., 2012a) suggest that climate conditions were more irregular during the Pleistocene. The Caatinga covers an area of more than 800,000 km² and it is characterized by a highly unpredictable climate with erratic rainfall and extensive droughts of irregular periodicity (Prado, 2003). Caatinga phytophisiognomies range from the prevailing shrublands (< 1m tall) to less common tree-dominated vegetations (> 25-30m tall) (Sampaio, 1995). Finally, the Chaco is an alluvial plain distributed by around 840,000 29 km2 in northern Argentina, western Paraguay, south-eastern Bolivia and a western fraction of the Brazilian state of Mato Grosso do Sul (Prado, 1993a,b; Pennington et al., 2000). The climate is highly seasonal, with very hot summers contrasting with severe winters; both annual rainfall and temperature decrease following an eastern-western gradient (Prado, 1993a). This environmental heterogeneity is reflected by the Chaco vegetation, which includes both forest and savanna-like formations (Prado, 1993a,b). Despite still incipient, the available information suggests that the complex evolution in the Neotropics was shaped by multiple factors acting at different spatial and temporal scales (Rull, 2011; d’Horta et al., 2013). In fact, the remarkable environmental heterogeneity and diversity in the DD vegetation formations appear to have been molded by a combined effect of the Paleogene-Neogene geomorphological events and the Pleistocene climate cycles (Werneck, 2011; Rull, 2011). For instance, the presence of geographical barriers, such as rivers and mountains (Faria et al., 2013; Nascimento et al., 2011, 2013), have also impacted the diversification within both Cerrado and Caatinga. In the Cerrado, its compartmentalization in plateaus (> 500m) and depressions (< 500m) due to Late Tertiary tectonic movements was also relevant (Colli et al., 2005; Nogueira et al., 2011). During the Pleistocene, DD vegetation formations and their associated biota have experienced shifts in their distributions according to an expansion-retraction dynamics (Turchetto-Zolet et al., 2013). During this time, some species have persisted in presumably stable areas (Bonatelli et al., 2014). Such climate-induced refugia have acted as biotic refugia in the context of the Pleistocene Refuge Hypothesis (Haffer, 2008; Vanzolini & Williams, 1981). In the Cerrado, phylogeographic surveys on both plant (Ramos et al., 2007; Novaes et al., 2010, 2013; Bonatelli et al., 2014) and animal taxa (Prado et al., 2012; Machado et al., 30 2014) have revealed both east-west and north-south disjunctions, corroborating the results of Ratter et al. (2003). Molecular dating analyses performed in these studies suggest that divergence events reflected by this pattern took place in the Middle Pleistocene. In the Seasonally Dry Tropical Forest (SDTF), successive expansion- fragmentation episodes during the Pleistocene have also likely occurred. However, the Caatinga has apparently maintained stable conditions during the Last Glacial Maximum (Werneck et al., 2011). In the Chaco, severe range shifts could have been caused by successive marine transgressions during Pleistocene, affecting many of its low-altitude regions (Werneck et al., 2011). However, Chaco biogeography is still controversial and poorly understood, since it is undoubtedly the least studied among the DD formations focused here (Werneck, 2011). Valuable insights on the biogeography of the DD formations could be gained from phylogeographic analyses of widely distributed species. The genome of such widespread species is expected to carry genetic signatures of historic shifts in environmental conditions throughout their ranges, contributing to unveil evolutionary processes at a continental scale (Lougheed et al., 2013). Unfortunately, molecular surveys concerning widespread species from the South American DD formations are still uncommon (Quijadas-Mascareñas et al., 2007; Gehara et al., 2014). In this context, the sigmodont rodent Necromys lasiurus (Lund, 1840) shows one of the largest ranges in the rodent subfamily Sigmodontinae (around 4 million km2), extending from the Amazon basin to northern Patagonia (Pardinãs et al., 2015). This wide geographic distribution is quite heterogeneous, encompassing a large environmental range that includes the DD formations and transitional areas among them and with adjoining vegetation formations such as the Amazon and Atlantic forests. 31 Necromys lasiurus is usually amongst the most common and abundant mammalian species in the DD formations (Streilein, 1982 a,b,c,d,e; Carmignotto et al., 2014). The species is also a
Materiais relacionados
Perguntas relacionadas
