07 Tese_Final_[TSC_040516]_CRC

Prévia do material em texto

INSTITUTO NACIONAL DE PESQUISAS DA AMAZÔNICA – INPA 
PROGRAMA DE PÓS-GRADUAÇÃO EM GENÉTICA, 
CONSERVAÇÃO E BIOLOGIA EVOLUTIVA 
 
 
 
 
 
 
Identificação molecular e integração de espécies 
amazônicas à filogenia molecular de fungos da ordem 
Phallales (Phallomycetidae, Basidiomycota) 
 
 
 
 
 
 
Tiara Sousa Cabral 
 
 
 
 
 
Manaus, Amazonas 
Abril, 2016
ii 
 
Tiara Sousa Cabral 
 
 
 
 
 
 
Identificação molecular e integração de espécies amazônicas à filogenia 
molecular de fungos da ordem Phallales (Phallomycetidae, Basidiomycota) 
 
 
 
 
Orientador: Dr. Charles R. Clement 
Co-orientadores: Drs. Iuri Goulart Baseia e Kentaro Hosaka 
 
 
 
 
Tese apresentada ao Instituto Nacional de 
Pesquisas da Amazônia como parte dos 
requisitos para obtenção do título de Doutor 
em Genética, Conservação e Biologia 
Evolutiva. 
 
 
 
 
Manaus, Amazonas 
Abril, 2016 
iii 
 
Ficha catalográfica 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
SINOPSE 
Com o estudo de espécimes da ordem Phallales coletados na Amazônia, estudados 
através de ferramentas de filogenia molecular aliados às análises de taxonomia 
morfológica, foi possível observar padrões de diversificação em níveis taxonômicos 
de gênero e espécie. Esses padrões permitiram um melhor entendimento da 
diversidade e evolução de fungos faloides, demonstrando a importância de se estudar 
áreas pouco amostradas, como as florestas Neotropicais. 
Palavras-chave: Fungos gasteroides, Phallales, filogenia molecular, delimitação de 
espécies, Neotrópicos, taxonomia. 
C117 Cabral, Tiara Sousa 
 Identificação molecular e integração de espécies amazônicas à 
filogenia molecular de fungos da ordem Phallales (Phallomycetidae, 
Basidiomycota) / Tiara Sousa Cabral. --- Manaus: [s.n.], 2016. 
 131 f. : il. color. 
 
 Tese (Doutorado) --- INPA, Manaus, 2016. 
 Orientador : Charles Roland Clement. 
 Coorientadores: Iuri Goulart Baseia, Kentaro Hosaka. 
 Área de concentração: Genética, Conservação e Biologia 
evolutiva. 
 
 1. Fungos gasteroides. 2. Phallales. 3. Filogenia molecular. I. Título. 
 
 CDD 589.2 
 
iv 
 
Agradecimentos 
Agradeço ao Prof. Charles R. Clement por ter aceitado me orientar durante o 
doutorado e por ter confiado na realização desse trabalho. Suas inúmeras sugestões e 
incentivos foram extremamente valiosas e levaram à plena realização deste projeto. Aos 
Profs. Iuri Goulart Baseia pela co-orientação e confiança no trabalho e Kentaro Hosaka por 
me aceitar em seu laboratório durante o período de doutorado sanduíche e por ter me 
mostrado as maravilhas do Japão. À Maria P. Martín, por estar sempre disposta a esclarecer 
minhas inúmeras dúvidas e pela co-orientação não oficial. Também agradeço à Noemia Kazue 
Ishikawa pelos preciosos ensinamentos, tanto acadêmicos quanto para a vida, e pelas 
oportunidades proporcionadas. À Doriane P. Rodrigues por ceder o laboratório de Evolução 
Aplicada para realizar os experimentos de genética molecular. 
 Aos companheiros de campo e laboratório, com quem pude dividir as frustrações e 
alegrias que os experimentos nos proporcionam! Agradeço à Bianca Denise (UFRN), por 
sempre estar disposta a ajudar nos estudos morfológicos. Agradeço aos meus amigos por 
proporcionarem horas de divertimento e distração! Agradeço a Flocos que sempre parecia 
saber quando eu já tinha passado tempo demais em frente ao computador, e me chamava para 
passear! 
 Em especial agradeço a Emanuell Ribeiro, meu companheiro, que participou 
ativamente nas diversas fases desse trabalho, que discutiu os resultados com a dedicação de 
como se fossem seus resultados! Sobretudo pela paciência que sempre teve, e entendimento 
das limitações que a vida que escolhemos nos impõe. E por não me deixar desistir. 
 Agradeço a minha família, minha mãe por acreditar em mim, meu pai por me 
incentivar a seguir nesse caminho, e a meus irmãos que além de acreditarem, nunca 
questionaram o caminho escolhido por mim. Sei que sempre estarão lá quando precisar. 
 Finalmente, agradeço ao Programa de Pós-Graduação em Genética, Conservação e 
Biologia Evolutiva do INPA, e às agências de fomento (CNPq, CAPES e FAPEAM) por 
terem concedido as bolsas de doutorado e doutorado sanduíche, e pelo financiamento da 
pesquisa. Agradeço também a todos os moradores das comunidades por onde passamos 
durante as coletas, que nos receberam com tanto carinho e atenção, e com quem aprendi um 
pouco da vida na Amazônia! 
 
v 
 
Resumo 
O presente trabalho teve como objetivo principal integrar espécies amazônicas à filogenia 
molecular da ordem Phallales com sequências diagnósticas padrões, e com este conjunto de 
dados inferir sobre a classificação e evolução do grupo. Para isso, coletas foram realizadas ao 
longo dos rios Amazonas, Solimões, Negro, Madeira e Tapajós. Os basidiomas coletados 
foram herborizados, depositados no Herbário do INPA, e fragmentos foram retirados para 
extração de DNA genômico. Foram obtidas sequências de ITS de todos os espécimes e, 
dependendo do grupo em estudo, foram obtidas sequências de outras regiões gênicas. 
Análises de Máxima Parcimônia e Bayesiana foram utilizadas para inferência filogenética 
molecular dos grupos em estudo, além da construção de árvores de espécies. Esta tese 
encontra-se dividida em quatro capítulos. No primeiro capítulo, uma espécie nova (Geastrum 
inpaense) e novos registros de fungos gasteroides são descritos: seis espécies constituem 
novos registros para Amazônia Central (Geastrum lloydianum, G. schweinitzii, Phallus 
merulinus, Staheliomyces cinctus), uma para o Brasil (Phallus atrovolvatus) e uma para 
América do Sul (Mutinus fleischeri). O segundo capítulo, dois novos registros de fungos 
faloides são descritos para o Brasil (Lysurus arachnoideus) e América do Sul (Phallus 
cinnbarinus), com descrições morfológicas detalhadas e fotos, além de sequências da região 
ITS. No terceiro capítulo, a diversidade observada entre espécimes coletados do gênero 
monotípico Xylophallus foi avaliada por meio de análises morfológicas aliadas a métodos de 
delimitação de espécies utilizando sequências de cinco regiões gênicas. As análises 
mostraram uma diversidade inesperada dentro do gênero ao revelar a presença de três 
unidades evolutivas: uma corresponde a X. xylogenus; uma é uma espécie nova denominada 
X. clavatus; e a terceira corresponde a uma espécie críptica – o primeiro registro em fungos 
faloides. No quarto capítulo, foi avaliada a diversidade morfológica e molecular de Phallus 
indusiatus sensu lato coletada na Amazônia brasileira. A árvore filogenética obtida com 
sequências de ITS revelou quatro clados distintos que possuiam concordância com os dados 
morfológicos. Um clado corresponde a P. indusiatus Vent., cujos espécimes apresentam 
caracteres morfológicos iguais ou bem próximos à descrição original. Os outros três clados 
possuem características distintas de P. indusiatus e quaisquer outras espécies com indúsio 
branco, correspondendo portanto a três novas espécies: P. amazonicus possui também uma 
variedade nova, P. amazonicus var. denigricans, diferenciada principalmente pela coloração 
escura da volva; P. squamulosus é caracterizada pela volva com superfície escamosa e foi 
encontrada na Mata Atlântica; P. purpurascens é a espécie mais distinta, sendo a maior entre 
as espécies citadas, possui volva branca a lilás, reticulações do receptáculo estreitas e esporos 
menores que as demais espécies. Até 2012, haviam apenas dois registros de Phallales para a 
Amazônia brasileira. Atualmente podem ser contabilizadas 13 espécies de fungos faloides 
para a Amazônia brasileira, sendo quatro dessas espécies novas para a ciência. Esses 
resultados demonstram a importância de estudar a micobiota de florestas Neotropicais, 
principalmentede grupos negligenciados como os fungos faloides. Demostra também a 
importância da inclusão de dados moleculares no estudo de taxonomia e sistemática de 
fungos, e como esses dados podem ser explorados. Testar diferentes regiões gênicas além de 
ITS – o barcode proposto de fungos – e métodos alternativos de delimitação de espécies 
também devem ser levados em consideração. 
 
vi 
 
Abstract 
The present study aimed to integrate Amazonian species to the molecular phylogeny of 
the order Phallales using standard DNA sequences, and with this, to make inferences about 
the classification and evolution of the group. Specimens were collected along the main rivers 
of the Amazon basin: Negro, Madeira, Solimões, Amazonas and Tapajós. The specimens 
were herborized, deposited at the INPA herbarium, and small fragments of basidioma were 
excised for DNA extraction. ITS sequences were obtained from all specimens, and sequences 
from additional DNA regions were obtained depending on the group of study. Maximum 
Parsimony and Bayesian analyses were performed for molecular phylogenetic inferences, in 
addition to construction of species trees. This thesis is divided in four chapters. In the first 
chapter, one new species (Geastrum inpaense) and new records of gasteroid fungi are 
described: six species are new records for Central Amazonia (Geastrum lloydianum, G. 
schweinitzii, Phallus merulinus, Staheliomyces cinctus), one for Brazil (Phallus atrovolvatus) 
and one for South America (Mutinus fleischeri). In the second chapter, two new records of 
phalloid fungi are described for Brazil (Lysurus arachnoideus) and South America (Phallus 
cinnbarinus), with detailed morphological descriptions and images, in addition to ITS 
sequences. In the third chapter, the diversity observed in specimens of the monotypic genus 
Xylophallus was evaluated using morphological analysis allied to methods of species 
delimitation using five DNA regions. The analyses showed unexpected diversity in 
Xylophallus, by revealing three evolutionary units: one corresponds to X. xylogenus; another 
is a new species named X. clavatus; and the third corresponds to a cryptic species – the first 
record for phalloid fungi. In chapter four, the morphological and molecular diversity found in 
Amazonian specimens of Phallus indusiatus sensu lato was evaluated. The phylogenetic tree 
obtained with ITS sequences revealed four distinct clades, which agreed with morphological 
data. One clade corresponds to P. indusiatus Vent., The other three clades are 
morphologically different from P. indusiatus and any other species with white indusium, thus 
corresponding to three new species: P. amazonicus, which also has a new variety, P. 
amazonicus var. denigricans differentiated by the darker volva; P. squamulosus is 
characterized by the squamous surface of the volva and it was found in the Atlantic 
Rainforest; P. purpurascens is the most distinct and the largest among these new species, it 
has a pinkish volva, smaller reticulations on the receptaculum and smaller spores than the 
other species. Until 2012, there were only two records of Phallales for Brazilian Amazonia. 
Currently, 13 species are recorded, of which four species are new to science. These results 
show the importance of studying mycobiota from Neotropical forests, especially neglected 
groups such as phalloid fungi. It also demonstrates the importance of including molecular data 
in the study of systematics and evolution of fungi, and how these data should be explored. 
Testing different DNA regions other than ITS – the proposed barcode for fungi – and 
alternative species delimitation methods should also be considered. 
vii 
 
Sumário 
 
Lista de Figuras .................................................................................................................................... viii 
Introdução Geral ...................................................................................................................................... 1 
Objetivos ................................................................................................................................................. 5 
Capítulo 01 .............................................................................................................................................. 6 
Capítulo 02 ............................................................................................................................................ 22 
Capítulo 03 ............................................................................................................................................ 29 
Capítulo 04 ............................................................................................................................................ 65 
Síntese ................................................................................................................................................. 100 
Referências Bibliográficas .................................................................................................................. 103 
Anexos................................................................................................................................................. 112 
 
 
 
viii 
 
Lista de Figuras 
 
Figura 1 Morfologia de Phallales. A. Phallus indusiatus; B. Itajahya galericulata; C. Clathrus 
ruber; D. Protubera maracuja. g. gleba; ps. pseusdoestipe; v. volva; p. perídio; en. 
Endoperídio; re. receptáculo; rz. rizomorfas. Adaptado de Miller e Miller 
(1988)...........................................2 
 
Capítulo 01 
Figura 1. Phylogenetic tree of Geastrum used to position G. inpaense within the genus 
constructed with Bayesian analysis, with posterior probabilities values on nodes. Herbarium 
vouchers follow the taxa name. ..................................................................................................9 
Figura 2. Geastrum inpaense macrostructures. Expanded basidiomata (a, b, c, d), scale bars 
correspond to 20 mm; peristome (e, f), scale bars correspond to 5 mm; hairs of mycelial layer 
indicated by arrows (g, h), scale bars correspond to 10 mm and 1 mm. Photographs by T.S. 
Cabral........................................................................................................................................11 
Figura 3. Geastrum inpaense microstructures. Endoperidium surface (a), spore ornamentation 
(b), capillitial hyphae with (c) and without (d) amorphous substance………………………..12 
Figura 4. Geastrum inpaense schematic drawing. Mycelial layer hyphae (a), bar = 10 µm; 
fibrous layer hyphae (b), bar = 10 µm; fleshy layer hyphae (c), bar = 20 µm; spores (d), bar = 
10 µm; basidia (e), bar = 10 µm. Illustration by D.S. Alfredo………………………………..13 
Figura 5. Geastraceae species. Geastrum lloydianum (a), Geastrum saccatum (b), Geastrum 
schweinitzii (c), Geastrum triplex (d). Photographs by T.S. Cabral………………………….14 
Figura 6. Phallaceae species. Phallus merulinus (a), Phallus atrovolvatus (b), Phallus 
indusiatus (c), Mutinus fleischeri (d), Staheliomyces cinctus (e). Scale bars correspond to 20 
mm. Photographs (a), (b) and (d) by N.K.Ishikawa, photographs (c) and (e) by T.S. 
Cabral…………………………………………………………………………………………15 
Figura 7. Morganella fuliginea. Expanded basidiomata (a); exoperidium sphaerocyst chains 
(b); spores in 5% KOH (c) and under SEM (d). Photograph by R.B. Neto..............................17 
 
Capítulo 02 
Figura 1. Lysurus arachnoideus (INPA 256537). A: Expanded basidioma. B: 
Basidiospores............................................................................................................................25 
Figura 2. Phallus cinnabarinus (INPA 255835). A: Expanded basidioma. B: Basidiospores. 
C: Pseudoparenchymatous hyphae of pseudostipe with pinkish pigment droplets…………..26 
ix 
 
 
Capítulo 03 
Figura 1. Geographic distribution of specimens of Xylophallus reportedin this study. Blue 
dots are specimens of Xylophallus clavatus, red dots are specimens of Xylophallus xylogenus 
and green dots are the X. xylogenus phylogenetic cryptic 
species………………………………….35 
Figura 2. Barplots showing the distribution of the absolute number of false positive (grey) and 
false negative (black) identifications across a range of pre-set threshold values on the x axis. 
(a) Ef-1α, (b) gpd, (c) rpb1, (d) rpb2, (e) 
ITS………………………………………………...........41 
Figura 3. Species tree based on five genes inferred by *BEAST. Values on nodes indicate 
posterior probabilities. Scale represents the estimated site substitution rates, by units of branch 
length………………………………………………………………………………………….42 
Figura 4. Macromorphology of Xylophallus clavatus. (a, b) Fresh basidiomata; (c) dried 
basidiomata with a longitudinal cut through the volva, showing the pseudostipe not attached 
to it; (d) dried basidiomata showing a minutely perforated apex; (e, f) immature basidiomata 
with protuberances on surface. Photos: Tiara S. 
Cabral…………………………………….............45 
Figura 5. Micromorphology of Xylophallus clavatus. (a) Basidiospores; (b) basidium at the 
yellow arrow; (c) pseudoparenchymatous hyphae of pseudostipe; (d) filamentous hyphae from 
volva…………………………………………………………………………………………..46 
Figura 6. Xylophallus xylogenus. (a, b) Fresh mature basidiomata; (c) Immature basidiomata 
fresh and (d) dried showing the smooth surface; (e) basidiospores; (f) pseudoparenchymatous 
hyphae of pseudostipe; (g) clavate basidia; (h) a representative of the Xylophallus cryptic 
species. Photos a-g: Tiara S. Cabral; h: Ricardo Braga Neto...................................................49 
 
Capítulo 04 
Figura 01. Currently known distributions of the new Phallus species described in this study. 
Colored areas are the Brazilian Biomes (IBGE 2016): Amazonian Rainforest (dark green), 
Cerrado (brown), Caatinga (beige), Atlantic Rainforest (light green), Pantanal (dark blue), 
Pampa (light blue)…………………………………………………………………………….66 
 
Figura 02. Phylogenetic tree obtained by Bayesian analysis. Colored clades correspond to 
Brazilian species: in blue, P. amazonicus; in green, P. purpurascens; in red, P. squamulosus; 
x 
 
in brown, P. indusiatus sensu stricto. Posterior probability values are on the nodes. The black 
dots indicate specimens under Phallus indusiatus deposited in Genbank and downloaded for 
this study….…………………………………………………………………………………..67 
 
Figura 03. Phallus amazonicus. (a) fresh basidiome, holotype; (b) volva with small hyphae 
projections on surface; (c) receptacle with a prominent pore and pale-yellow color (TSC 248); 
(d) spores; (e) hyphae from volva; (f) rhizomorphs hyphae; (g) crystals in globose cells found 
on volva……………………………………………………………………………………….71 
 
Figura 04. Phallus amazonicus var. denigricans fresh basidiome. a. whole basidiome; b. 
blackish and smooth volva in detail. Bars = 20 mm. (c) spores; (d) pseudoparenchymatous 
hyphae of pseudostipe; (e) hyphae from rhizomorphs; (f) hyphae from 
volva…………………………..................................................................................................73 
 
Figura 05. Phallus purpurascens (a) fresh basidiome; (b) longitudinal section of an immature 
basidiome, showing the purplish volva and rhizomorphs; (c) gregarious immature basidioma, 
with purplish pigments on surface. Bars correspond to 20 mm. (d) spores; (e) rhizomorphs 
hyphae; (f) pseudoparenchymatous hyphae from pseudostipe; (g) hyphae from volva; (h) 
crystals in globose cells found on volva………………………………………………….….76 
 
Figura 06. Phallus squamulosus DT 253 (a) fresh basidiome and (b) immature basidiome with 
squamous surface. Bars correspond to 20 mm. (c) spores; (d) pseudoparenchymatous hyphae 
from pseudostipe; (e) hyphae from volva; (f) hyphae from rhizomorphs and crystals deposits 
on globose cells……………………………………………………………………………….79 
 
Figura 07. Phallus indusiatus fresh basidiome. (a) TSC 148; (b) TSC 135, showing the volva 
with pinkish pigments. Bars correspond to 20 mm..................................................................81 
 
1 
 
Introdução Geral 
Os fungos constituem um vasto Reino de organismos eucariotos heterotróficos com 
morfologia e dimensões muito distintas, variando desde formas microscópicas até formas 
macroscópicas. No passado os fungos foram tratados como pertencendo ao Reino das Plantas 
devido à semelhanças compartilhadas, e só foram considerados um reino a parte quando 
Whittaker (1959) propôs o estabelecimento do Reino Fungi. O filo Basidiomycota possui 
mais de trinta mil espécies (Webster & Weber 2007), caracterizado principalmente por 
possuírem estruturas chamadas basídios onde são produzidos os esporos. 
A classe Agaricomycetes constitui 98% do subfilo Agaricomycotina (Basidiomycota), e é 
composta pelos fungos que produzem corpos de frutificação, conhecidos popularmente por 
cogumelos (Kirk et al. 2008). As espécies desta classe podem ser divididas em duas grandes 
categorias: formas não gasteroides (agaricoides, boletoides, poliporoides, etc.) e gasteroides 
(“puffballs, “birds nest fungi”, “stinkhorns”, etc.). A principal diferença entre esses grupos é 
a forma de liberação dos esporos, que é por balistosporia (liberação ativa, com gasto de 
energia) em não gasteoides, e estatismosporia (liberação passiva, dependente de agentes 
externos) em gasteroides (Wilson et al. 2011) 
Os fungos gasteroides evoluíram de maneira independente em diferentes linhagens dentro 
dos basidiomicetos. Portanto, essa morfologia convergente não é considerada para 
classificação, uma vez que a forma gasteroide é considerada uma homoplasia (Moncalvo et al. 
2002; Wilson et al. 2011). Os gasteroides então encontram-se desmembrados em várias 
ordens dentro de Basidiomycota. Na subclasse Phallomycetidae, porém, das quatro ordens 
que a compõem, duas são compostas inteiramente por fungos gasteroides: Phallales e 
Geastrales (Hosaka et al. 2006). 
Os fungos faloides (ordem Phallales) são caracterizados principalmente por possuírem a 
gleba – porção onde são formados os esporos – mucilaginosa com odor fétido que atrai 
agentes dispersores, em sua maioria insetos. Possuem uma parede externa denominada 
perídio, composta de duas a três camadas; inicialmente o perídio envolve completamente o 
receptáculo e a gleba, e na maturidade pode se romper a partir do ápice, como ocorre na 
maioria das espécies (Cunningham 1944). Podem apresentar o desenvolvimento hipógeo e/ou 
epígeo (abaixo e acima da terra, respectivamente). As famílias Trappeaceae, Claustulaceae, 
Protophallaceae e Gastroporiaceae são caracterizadas por não possuírem pseudoestipe, e em 
algumas espécies o perídio permanece fechado mesmo após a maturação da gleba, o que 
confere um corpo de frutificação oval a piriforme. O basidioma pode variar de um 
2 
 
pseudoestipe oco com a gleba localizada no ápice formando o receptáculo, como em 
Phallaceae e Lysuraceae, a uma estrutura em forma de gaiola (Clathraceae) formada por 
braços que se intercruzam, onde localiza-se a gleba (Figura 01). 
 
Figura 1 Morfologia de Phallales. A. Phallus indusiatus; B. Itajahya galericulata; C. Clathrus ruber; D. 
Protubera maracuja. g. gleba; ps. pseusdoestipe; v. volva; p. perídio; en. Endoperídio; re. receptáculo; rz. 
rizomorfas. Adaptado de Miller e Miller (1988). 
 
Os faloides são cosmopolitas e efêmeros, com a maioria das espécies sapróbias. Suas 
rizomorfas podem ser encontradas se estendendo às raízes enterradas e pedaços de madeira 
em decomposição (Miller & Miller 1988), sendo comum também a frutificação em folhiço, 
exercendo papel importante na ciclagem de matéria orgânica (Leite et al. 2007). O mau cheiro 
exalado pela gleba tem como finalidade a atração de insetos que se alimentam dela, 
caracterizando uma importante e diferente estratégia de dispersão de esporos para os fungos 
(Tuno 1998; Oliveira & Morato 2000).Este grupo tem sido estudado por décadas e estes estudos tem revelado uma grande 
diversidade ao redor do mundo. Apesar da sua grande diversidade, ainda há lacunas no 
conhecimento do grupo, tanto relacionado a taxonomia quanto a distribuição geográfica. 
3 
 
Recentemente, Trierveiler-Pereira et al. (2014) propuseram uma nova filogenia para a ordem 
Phallales, focando em gêneros sub-representados, incluindo espécies tropicais e sub-tropicais. 
Porém, apesar de as relações entre as famílias estarem aparentemente bem estabelecidas, as 
relações entre os gêneros dentro de cada família ou ainda a delimitação taxonômica entre os 
taxa, ainda são conflitantes, o que resulta em um grande número de sinonímias para a ordem 
Phallales. Isso em parte se deve à dificuldade em separar morfologicamente os taxons, devido 
à escassez e plasticidade dos caracteres diagnósticos (Begerow et al. 2010). Aliado a isso, o 
fato de possuírem frutificação efêmera e a difícil preservação do material também influenciam 
nos estudos de taxonomia e sistemática das espécies nessa ordem. 
Ao se integrar dados moleculares aos fenotípicos, muitos caracteres morfológicos 
mostram-se homoplásicos ou filogeneticamente não informativos (Begerow et al. 2006; 
Cabral et al. 2012; Marincowitz et al. 2015), e a evolução morfológica convergente parece ser 
bem difundida entre fungos (Hibbett & Hawksworth 2007). Assim, dados de filogenia 
molecular e delimitação por DNA barcode podem ser utilizados como uma importante 
ferramenta para auxiliar estudos de sistemática e evolução desses fungos. De fato, vários 
estudos moleculares tem revelado novas espécies e a existência de complexos de espécies e 
espécies crípticas (Zhao et al. 2008; Cabral et al. 2012; Degreef et al. 2013; Li et al. 2014; Li 
et al. 2005; Desjardin & Perry 2009). Apesar do número crescente de estudos filogenéticos 
em fungos faloides (Hosaka et al. 2006; Degreef et al. 2013; Trierveiler-Pereira et al. 2014; 
Trierveiler-Pereira & Meijer 2014; Li et al. 2014; Marincowitz et al. 2015; da Silva et al. 
2015), a classificação infragenética de espécies já descritas ainda permanence inconsistente. 
Os faloides possuem distribuição geográfica ampla, porém acredita-se que a maior 
diversidade deste grupo seja encontrada em regiões tropicais e subtropicais (Hawksworth 
2001). De fato, vários registros e novas espécies vêm surgindo nos últimos anos para África 
tropical (Dring 1964; Calonge & Kreisel 2002; Desjardin & Perry 2009; Marincowitz et al. 
2015), Ásia e Oceania tropicais (Kasuya 2007; Kasuya 2008; Hosaka 2010; Li et al. 2014; 
Rebriev et al. 2014), América Central (Saénz & Nassar 1982; Calonge et al. 2005; Hemmes & 
Desjardin 2009), e América do Sul (Baseia et al. 2003; Baseia & Calonge 2005; Gómez & 
Gazis 2006; Ottoni et al. 2010; Cheype 2010; Cabral et al. 2012; Cortez et al. 2011; da Silva 
et al. 2015). No entanto, no Brasil esses estudos estão restritos basicamente à Mata Atlântica, 
de forma que dados sobre outras regiões que englobam ecossistemas diferentes são 
inexistentes ou escassos. 
A floresta Amazônica, que representa 62% da área total do território brasileiro, é 
mundialmente reconhecida pela alta biodiversidade, e ainda assim a micobiota é pouco 
4 
 
conhecida. Na Amazônia brasileira, até 2012 havia apenas dois registros de Phallales, as 
espécies Phallus indusiatus e Mutinus caninus para o Estado de Rondônia (Trierveiler-Pereira 
et al. 2009; Trierveiler-Pereira et al. 2011), além de 21 registros no Herbário INPA para a 
família Phallaceae. A Amazônia vem sendo continuamente desmatada e a consequente 
fragmentação do habitat é preocupante para a manutenção da biodiversidade, uma vez que 
contribui para a perda de espécies endêmicas e não descritas, além das espécies descritas 
(Fearnside 2005; Haddad et al. 2015). A fragmentação de habitat também é uma ameaça para 
a micobiota (Dahlberg et al. 2010; Dahlberg & Mueller 2011), e por isso é importante obter 
informações sobre a diversidade e distribuição de fungos em áreas ameaçadas, como áreas de 
floresta Amazônica. 
A falta de dados sobre a biodiversidade possui implicações significantes em vários 
aspectos, como hipóteses filogenéticas, relações coevolutivas e interpretações de padrões 
biogeográficos (Mueller & Schmit 2007). O desenvolvimento de estudos de fungos faloides 
em áreas sub-amostradas e ameaçadas, como a floresta Amazônica, com uma abordagem 
englobando dados morfológicos e de filogenia molecular, possibilitará um maior 
entendimento da diversidade e evolução do grupo. Isso permitirá também estudos de revisões 
taxonômicas, como também a delimitação confiável de espécies para apoiar posteriores 
estudos de ecologia e conservação, assim como a avaliação da biodiversidade (Begerow et al. 
2010). 
Os quatro capítulos apresentados a seguir contribuem para o conhecimento da diversidade 
de fungos faloides da Amazônia brasileira, e demonstram como o conhecimento dessa 
diversidade altera o atual entendimento da sistemática e evolução da ordem Phallales em 
níveis infragenéricos. Os resultados aqui apresentados consistem nos primeiros levantamentos 
de fungos faloides para a Amazônia brasileira, aliando dados morfológicos e moleculares. 
 
5 
 
Objetivos 
O objetivo geral deste trabalho foi integrar espécies amazônicas à filogenia molecular 
da ordem Phallales com sequências diagnósticas padrões e DNA barcodes. 
Os objetivos de cada capítulo foram os seguintes: 
• Capítulos 01 e 02 - Caracterizar morfo e molecularmente as espécies de fungos 
gasteroides, principalmente da ordem Phallales, coletadas em períodos chuvosos 
ao longo dos rios Amazonas-Solimões e Negro-Madeira; 
• Capítulo 03 – Analisar a diversidade observada entre espécimes do gênero 
monotípico Xylophallus por meio de análises morfológicas aliadas a métodos de 
delimitação de espécies utilizando sequências de cinco regiões gênicas. 
• Capítulo 04 - Avaliar a diversidade morfológica e molecular de Phallus 
indusiatus sensu lato coletados no Brasil, principalmente na Amazônia brasileira. 
 
6 
 
 
 
 
 
 
 
 
 
 
 
 
Capítulo 01 
___________________________________________________________________________ 
Cabral, T.S.; da Silva, B.D.B.; Ishikawa, N.K.; 
Alfredo, D.A.; Braga-Neto, R.; Clement, C.R.; 
Baseia, I.G. 2014. A new species and new 
records of gasteroid fungi (Basidiomycota) 
from Central Amazonia, Brazil. Phytotaxa, 
183(4), pp.239–253. 
7 
 
 
8 
 
 
9 
 
 
10 
 
 
11 
 
 
12 
 
 
13 
 
 
14 
 
 
15 
 
 
16 
 
 
17 
 
 
18 
 
 
19 
 
 
20 
 
 
21 
 
 
22 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
Capítulo 02 
___________________________________________________________________________ 
Cabral, T.S., Clement, C.R. & Baseia, I.G., 2015. 
Amazonian phalloids: new records for Brazil 
and South America. Mycotaxon, 130(2), 
pp.315–320. 
 
23 
 
 
24 
 
 
25 
 
 
26 
 
 
27 
 
 
28 
 
 
29 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
Capítulo 03 
________________________________________________________________ 
Multiple Loci and Morphology Reveal a New 
Species and Hidden Diversity in the Genus 
Xylophallus (Phallomycetidae, Basidiomycota). 
Tiara S. Cabral, María P. Martín, Charles R. 
Clement, Kentaro Hosaka, Iuri G. Baseia. 
Manuscrito submetido para PLoS ONE 
 
30 
 
 
31 
 
 1 
Full title: Multiple Loci and Morphology Reveal a New Species and Hidden Diversity in 2 
the Genus Xylophallus (Phallomycetidae, Basidiomycota) 3 
Short title: Hidden Diversity in the Genus Xylophallus 4 
Tiara S. Cabral1*, María P. Martín2, Charles R. Clement3, Kentaro Hosaka4, Iuri G. Baseia5 5 
 6 
1. Post-graduate Program in Genetics, Conservation and Evolutionary Biology, Instituto 7 
Nacional de Pesquisas da Amazônia (INPA), Manaus, Amazonas, Brazil. 8 
2. Department of Mycology, Real JardínBotánico-CSIC, Plaza de Murillo 2, Madrid, Spain. 9 
3. Department of Technology and Innovation, INPA, Manaus, Amazonas, Brazil. 10 
4. Department of Botany, National Museum of Nature and Science, Tsukuba, Ibaraki, Japan. 11 
5. Departament of Botany and Zoology, Universidade Federal do Rio Grande do Norte, Natal, 12 
Rio Grande do Norte, Brazil. 13 
*Corresponding author 14 
E-mail: ttiara@gmail.com 15 
 16 
Abstract 17 
The Amazon rainforest is the largest Neotropical Biome and plays essential roles in terrestrial 18 
carbon storage and climate. Although it is a highly biodiverse biome, the diversity and 19 
distribution of fungal species are still poorly known. The Amazon rainforest is being 20 
deforested and habitat fragmentation is a serious threat for mycobiota. Information about 21 
fungal species diversity and distribution in Amazonia is important, as they are important 22 
ecosystem members. Xylophallus xylogenus is the smallest phalloid fungi described to date. 23 
Xylophallus was considered monospecific and is geographically restricted to the Neotropics. 24 
During field trips in Amazonia, morphological variations within Xylophallus were observed. 25 
We evaluated six independent DNA regions and their power for discovering putative species 26 
32 
 
in the genus. We also estimated the species trees for the genus and we tested competing 27 
models of species delimitation using Bayes factors. The results reveal the presence of three 28 
evolutionary units within the genus: one is X. xylogenus; another is a new species; and the 29 
third appears to be a cryptic species – the first recorded in phalloid fungi. These findings 30 
demonstrate the mycological richness of Neotropical forests. 31 
 32 
1. Introduction 33 
The Amazon rainforest is the largest Neotropical Biome and contains about 40% of 34 
the world’s remaining tropical rainforests. The forest plays essential roles in terrestrial carbon 35 
storage and climate, and is a highly diverse biome, hosting about 25% of world’s known 36 
biodiversity (Malhi et al. 2008). Nonetheless, the diversity and distribution of numerous taxa 37 
are still poorly known or unknown in Amazonia (Fearnside 2006). This is particularly true for 38 
the megadiverse kingdom Fungi, which is species-rich in tropical forests, and plays a crucial 39 
role in ecosystem functions (Hawksworth & Rossman 1997; Arnold & Lutzoni 2007; 40 
Tedersoo et al. 2014). 41 
The Amazon rainforest has been continuously deforested for economic reasons (Fearnside 42 
2006). Habitat fragmentation caused by deforestation is of major concern for maintenance of 43 
biodiversity, since it contributes to the loss of known, endemic and undescribed species 44 
(Fearnside 2005; Haddad et al. 2015). Since habitat fragmentation is one of the main threats to 45 
fungal diversity (Dahlberg et al. 2010; Dahlberg & Mueller 2011), it is important to have 46 
information about fungal species diversity and distributions in endangered tropical systems, 47 
such as the Amazon rainforest. Although fungi receives limited attention in conservation 48 
biology, it provides services for other organisms including humans and can act as indicators 49 
of disturbances in ecosystems (Heilmann-Clausen et al. 2015). Therefore, information about 50 
33 
 
fungal species diversity and distribution is important for the development of conservation 51 
strategies. 52 
Species description is essential for biodiversity assessment and conservation studies 53 
(Peterson & Navarro-Sigüenza 1999; Agapow et al. 2004; Frankham et al. 2012; Ortega-54 
Andrade et al. 2015). Traditionally, fungal species have been described using morphological 55 
characters, but this can be difficult due to the lack and/or plasticity of characters used in 56 
taxonomic classification (Begerow et al. 2010; Suwannasai et al. 2013). When integrating 57 
molecular and morphological data for taxonomic studies, several morphological characters 58 
seem to be homoplasic or phylogenetically uninformative (Begerow et al. 2006; Cabral et al. 59 
2012; Zamora et al. 2014), which leads to frequent changes in classification. In this way, 60 
different methods of fungal species recognition have been used according to the taxonomic 61 
group under study. 62 
The phalloid fungi is a very distinctive group of gasteroid fungi (Basidiomycota) 63 
characterized mainly by the mucilaginous and fetid spore mass that attracts dispersal agents, 64 
mostly insects. They have been studied for decades and these studies have revealed great 65 
diversity all over the world (Li et al. 2002; Leite et al. 2007; Desjardin & Perry 2009; da Silva 66 
et al. 2015; Marincowitz et al. 2015). Phalloid fungi are very ephemeral and a small number 67 
of morphological characters are used to identify species, such as basidiomata (fruit body) 68 
shape and color (Dring 1980). For this reason, infrageneric classification of phalloid species is 69 
often inconsistent. 70 
In this paper, we describe a new species and report the existence of a geographically 71 
restricted cryptic species in the genus Xylophallus (Schltdl.) E. Fisch based on morphological 72 
and molecular data. To date, this genus contained only one species, Xylophallus xylogenus 73 
(Mont.) E. Fisch., the smallest phalloid yet described (up to 15 mm high). It is always found 74 
on rotten wood and is currently restricted to northern South America (French Guiana, Brazil, 75 
34 
 
Peru, Ecuador) and southern Central America (Costa Rica) (Trierveiler-Pereira & da Silveira 76 
2012). Several attempts were made to properly classify this species: it was treated as section 77 
Xylophallus in Phallus (Schlechtendal 1861), reallocated to Mutinus (Fischer 1898) and 78 
finally a distinct genus Xylophallus (Schltdl.) E. Fisch. was erected (Fischer 1933). In the 79 
most recent phylogeny of the order, based on DNA sequences of three independent genes, 80 
Xylophallus is in fact an independent genus and it is closely related to the genus Mutinus 81 
(Trierveiler-Pereira et al. 2014). Despite these efforts to classify it, there are still few 82 
specimen records of this species (Baseia et al. 2003; Gómez & Gazis 2006; Cheype 2010; 83 
Trierveiler-Pereira & da Silveira 2012), which prevents significant comparisons of collections 84 
from different localities. 85 
Field trips in Amazonia enabled us to collect numerous specimens of Xylophallus 86 
xylogenus with great morphological differences. We found unexpected diversity in genus 87 
Xylophallus when evaluating the power of species discovery of six independent DNA regions 88 
and estimating their species trees, and combining these with morphological differences. The 89 
discovery of such diversity in a rare genus restricted to Neotropical forests demonstrates the 90 
importance of studying the mycobiota of under-sampled and threatened areas, and especially 91 
the usage of molecular data allied with morphological analysis on the discovering of new 92 
fungal taxa. 93 
 94 
2. Material and Methods 95 
a. Taxon sampling 96 
Specimens of Xylophallus were collected in Brazilian Amazonia during the rainy 97 
season from 2013 to 2015 along the main rivers of the Amazon basin: Negro and Madeira 98 
Rivers (North and South axis) and Solimões and Amazonas Rivers (East and West axis). 99 
Additional sampling was done along the lower Tapajós River, and in Cayenne (French 100 
35 
 
Guiana) (Fig 1). The specimens were collected in ombrophilous dense forests, both in old-101 
growth and secondary upland forests. Collections were authorized by Sisbio 37506/2012, 102 
38853/2013 and 43426/2014. 103 
 104 
Fig 1. Geographic distribution of specimens of Xylophallus reported in this study. Blue 105 
dots are specimens of Xylophallus sp. nov., red dots are specimens of Xylophallus xylogenus 106 
and green dots are the X. xylogenus phylogenetic cryptic species. 107 
 108 
We collected basidiomatarandomly along pre-existing trails. An electric dryer was 109 
used at 40°C during 48 hours to herborize material. After identification, the material was 110 
deposited at the INPA herbarium. 111 
36 
 
Recently, the synonymy of Phallus pygmaeus to Xylophallus xylogenus was proposed 112 
(Cheype 2010). Because the type locality of Phallus pygmaeus is the Brazilian Atlantic 113 
Forest, additional specimens were requested from the herbaria Padre Camille Torrand (URM) 114 
and UFRN-Fungos, and included in analyses. A specimen from Costa Rica was kindly 115 
provided by Dr. Clark Ovrebo, University of Central Oklahoma. 116 
b. Morphological analyses 117 
Specimens were studied at the Laboratory of Fungi Biology, Federal University of Rio 118 
Grande do Norte, and at the Laboratory of Botany, National Research Institute for Amazonia. 119 
Microscopes and stereoscopes were used to analyze microstructures, following traditional 120 
methodology for phalloid fungi taxonomy (Baseia et al. 2006; Cortez et al. 2011; Kornerup & 121 
Wanscher 1978). We made cuts from the different layers, including gleba, which were 122 
mounted on separate slides with 5% KOH. The hyphae were separated until they became 123 
homogenous, when they were observed under the microscope. We took 20 measurements 124 
from each structure. Species identification as well as descriptions were made by observing the 125 
micro and macrostructures, and were based on the specific literature for this group of fungi 126 
(Calonge 2005; Kreisel 1996; Trierveiler-Pereira & da Silveira 2012). Mycological 127 
nomenclature followed Kirk et al. (2008). 128 
 129 
 130 
 131 
c. Phylogenetic analyses 132 
i. DNA extraction, PCR and sequencing 133 
DNA extraction was done from immature basidiomata for all specimens, following 134 
Hosaka (2009). The DNA sequences were obtained for five independent regions: internal 135 
transcribed spacer (ITS) from rDNA, translation elongation factor subunit 1α (EF-1α), 136 
37 
 
glyceraldehyde 3-phosphate dehydrogenase (gpd), and genes encoding the two largest 137 
subunits of RNA polymerase II (rpb1 and rpb2). First, we amplified and sequenced the four 138 
protein genes for part of the specimens to check for the existence of variable regions. Then, 139 
we developed specific primers for Xylophallus xylogenus, targeting the variable regions of the 140 
protein genes (Table 01), using Primer3 (Rozen & Skaletsky 2000). For ITS, we used the 141 
primer pairs ITS5 and ITS4 (White et al. 1990). We obtained the complete data set of all five 142 
genes for most of the specimens. PCR reactions had a final volume of 10 µl, each containing 143 
5 µl of EmeraldAmp® MAX PCR Master Mix (2X Premix) (Takara), 0.25 µl of each primer 144 
(5 mM) and 1 µl of genomic DNA. The PCR cycling parameters for all genes were 1 cycle of 145 
94°C for 3 min, 35 cycles of 94°C for 35 sec, 51°C for 30 sec and 72°C for 1 min, and a final 146 
extension of 72°C for 10 min. The DNA fragments were visualized in 1 % agarose gels 147 
stained with GelRed™ (Biotium) under UV light. The fragments were purified using Ilustra 148 
ExoProStar (GE Healthcare) and sequenced using Big Dye Terminator Cycle Sequencing Kit 149 
(Applied Biosystems) with the same primer pairs used for PCR for each gene, except for ITS 150 
where the primer pair ITS1/ITS4 was used (White et al. 1990). Overall, the protein genes 151 
were easily amplified and sequenced; on the other hand, 21 of 78 specimens presented double 152 
peaks in ITS sequence electropherograms, even though it was easily amplified. For this 153 
reason, we used a clone sequencing protocol aiming to better resolve the ITS sequences for 154 
some specimens. After cloning, there were at least two different copies of ITS sequences for 155 
some specimens and all ribotype copies were used for gene tree reconstruction and DNA 156 
barcoding analyses, but not for species delimitation with Bayes factors. 157 
 158 
Table 1. Specific primers designed for Xylophallus. 159 
DNA region Primer names Sequences 
EF-1α EF-Xy1F GCTTTTACCCTCGGTGTGAG 
38 
 
EF-Xy2R CAAGGTCTTTCCCTTCACCA 
gpd 
GPD-Xy1F CCTCGACGTCAGTTACATGG 
GPD-Xy2R GCGAGTATACCCTGGTGGAA 
rpb1 
RPB1-Xy1F TAGATGGATTCGCCACACAA 
RPB1-Xy2R CATCCACGGCGATACTAGGT 
rpb2 
RPB2-Xy1F GAAACACACAAGGAATTCAACC 
RPB2-Xy2R AATCATGCTGGGATGGATCT 
 160 
 161 
ii. DNA barcoding 162 
Eletropherogram visualization, contig assembly, and alignments were made with 163 
Geneious R6.1 (Biomatters Ltd.), creating five DNA sequence matrices (available at 164 
TreeBase ID 18935). Five markers were analyzed for their potential for species discovery 165 
(Schindel & Miller 2005) by investigating the existence of a barcoding gap (Meyer & Paulay 166 
2005) in each gene database, testing several genetic distance threshold values. For this, a false 167 
positive and false negative identification analysis across a range of possible genetic distance 168 
thresholds calculated based on intra- and interspecific distance values, following Stefani et al. 169 
(2014), was performed. For this analysis, we used the threshold optimization approach in R 170 
package SPIDER (Brown et al. 2012). With this package, the genetic distance matrices using 171 
p-distance for each gene were calculated. Based on these matrices, barplot graphs were 172 
constructed for each gene showing the false positive (grey bars) and false negative (black 173 
bars) rates of species identification according to a range from 0.1% to 2% (3% for ITS) of 174 
genetic distance values. When there is no false identification, there is perfect sequence 175 
assignment to species, and so there is a threshold value that can be considered as a barcode 176 
gap (Brown et al. 2012). 177 
iii. Gene trees, species trees and species delimitation 178 
39 
 
To understand the evolutionary patterns in the genus, we constructed phylogenetic 179 
trees for each gene separately and for the four protein genes concatenated. We used PAUP* 180 
(Swofford 1998) for Maximum Parsimony analysis and MrBayes 3.1.2 to perform Bayesian 181 
analysis (Huelsenbeck & Ronquist 2001). Substitution models were chosen in MrModelTest 182 
2.3 (Nylander 2004). The outgroup was defined according to the most recent Phallales 183 
phylogeny (Trierveiler-Pereira et al. 2014). In both analyses, the phylogenetic reconstruction 184 
with protein genes resulted in trees with basically the same topology, where two 185 
monophyletic clades could be observed, while ITS analysis showed no congruence with either 186 
morphological data or protein genes phylogenetic trees (Fig S1 and S2). Interestingly, with 187 
the ITS analysis, a monophyletic clade composed only of specimens from the Madeira River 188 
basin was recovered. Because of this incongruence we estimated species trees using *BEAST 189 
implemented in BEAST v.1.8.2 (Drummond & Rambaut 2007; Heled & Drummond 2010). 190 
We also ran species delimitation analysis using Bayes factors, with the marginal likelihoods 191 
calculation implemented in *BEAST (Grummer et al. 2014). 192 
For *BEAST analyses, the model K80 was chosen for EF-1α and rpb1 partitions, 193 
TrNef for gpd, K80+G for ITS and rpb2, all chosen with jModelTest (Darriba et al. 2012). We 194 
selected the Yule speciation process with a strict clock model (fixed rate for EF-1α and the 195 
rates for other partitions estimated relative to this gene) (Drummond et al. 2006), and 196 
population size as piecewise linear and constant root. We used the default values for the rest 197 
of the prior settings. The analysis was run for 50 million generations, sampling at every 5000. 198 
For species delimitation through model testing using Bayes factor, we used the marginal 199 
likelihood estimator through a stepping-stone process with chain length of 10 million 200 
generations for 100 path steps. Two different analyses were run, one considering three species201 
(model M0: X. xylogenus, X. sp. nov. and a third phylogenetic species composed of specimens 202 
from Madeira river basin), and another considering of two species (model M1: X. xylogenus 203 
40 
 
and X. sp. nov.). Then the calculated Bayes factors (2lnBf) were used to evaluate which model 204 
best explains the data, following Grummer et al. (2014) and Kass and Raftery (1995). 205 
The convergence was calculated with TRACER v1.6 (Rambaut et al. 2014) and trees 206 
were summarized with TREEANNOTATOR 1.7.0 (Rambaut & Drummond 2013). All 207 
phylogenetic trees were visualized and edited with FigTree v1.4.2 (Rambaut 2012) and the 208 
confidence values were calculated with posterior probabilities (PP). 209 
 210 
Nomenclature 211 
The electronic version of this article in Portable Document Format (PDF) in a work with 212 
an ISSN or ISBN will represent a published work according to the International Code of 213 
Nomenclature for algae, fungi, and plants, and hence the new names contained in the 214 
electronic publication of a PLOS article are effectively published under that Code from the 215 
electronic edition alone, so there is no longer any need to provide printed copies. 216 
In addition, new names contained in this work have been submitted to MycoBank from 217 
where they will be made available to the Global Names Index. The unique MycoBank number 218 
can be resolved and the associated information viewed through any standard web browser by 219 
appending the MycoBank number contained in this publication to the prefix 220 
http://www.mycobank.org/MB/815135. The online version of this work is archived and 221 
available from the following digital repositories: PubMed Central and LOCKSS. 222 
 223 
3. Results 224 
A total of 73 specimens were collected in Brazilian Amazonia and French Guyana, 225 
and 4 more specimens from the Brazilian Atlantic rainforest and 1 from Costa Rica were 226 
borrowed from herbaria. Collection localities and herbarium vouchers are described in Table 227 
41 
 
S3. We discovered one new species belonging to the genus Xylophallus based on 228 
morphological and molecular data, and one new cryptic species. 229 
a. Barcoding analyses 230 
A total of 76 specimens were used for phylogenetic analyses. We obtained 364 DNA 231 
sequences in this study (72 EF-1α, 72 gpd, 76 ITS, 75 rpb1 and 69 rpb2), which were 232 
deposited at Genbank – the accession numbers can be found in Table S3. The alignment 233 
lengths for each gene were 303 bp for EF-1α, 791 bp for gpd, 533 bp for ITS, 525 bp for rpb1 234 
and 706 bp for rpb2. 235 
The barplot graphs (Fig 2) that resulted from threshold optimization analysis show both 236 
the absolute number of false positive (in grey) and false negative (in black) species 237 
identifications for all five genes, considering the existence of three distinct evolutionary units. 238 
In other words, this analysis showed the absence of universal barcode gaps; therefore it was 239 
not possible to clearly identify the species limits through standard genetic distance 240 
differentiation methods. 241 
 242 
Figure 2. Barplots showing the distribution of the absolute number of false positive 243 
(grey) and false negative (black) identifications across a range of pre-set threshold 244 
values on the x axis. (a) Ef-1α, (b) gpd, (c) rpb1, (d) rpb2, (e) ITS. 245 
42 
 
 246 
b. Phylogenetic analyses 247 
The species tree, estimated based on the five-genes dataset in *BEAST, clearly 248 
supports (PP>0.95) a hypothesis of three distinct evolutionary units, herein considered 249 
different species (Fig 3). One of the clades is composed of the specimens distributed along the 250 
upper Solimões, Amazonas and Negro Rivers, Amanã Lake, and the lower Tapajós River, 251 
here named Xylophallus clavatus (blue clade in Fig 3, Fig S1 and S2; blue distribution in Fig 252 
1). Its sister clade is composed of specimens of Xylophallus xylogenus sensu lato (red clade in 253 
Fig 3, Fig S1 and S2; red distribution in Fig 1), distributed along the middle and lower 254 
Solimões River, lower Negro River, Cayenne and the Brazilian Atlantic rainforest. Specimens 255 
distributed along the Madeira River compose the third and sister clade of X. xylogenus (green 256 
clade in Fig 3, Fig S1 and S2; green distribution in Fig 1). When the Bayes factor 2lnBf > 10, 257 
there is strong evidence of M0 over M1 (Kass & Raftery 1995). Hence, our data set is more 258 
likely to be composed of three phylogenetic species than two (Table 2). 259 
 260 
Table 2. Xylophallus species delimitation based on five gene sequences using model 261 
selection with the Bayes factor approach. 262 
Model Hypothesis log marginal 
likelihood 
2lnBf 
M0 3 species (X. clavatus, X. xylogenus, cryptic 
species) 
-5131.63 49.96 
M1 2 species (X. clavatus, X. xylogenus) -5156.61 
 263 
 264 
43 
 
 265 
Fig 3. Species tree based on five genes inferred by *BEAST. Values on nodes indicate 266 
posterior probabilities. Scale represents the estimated site substitution rates, by units of branch 267 
length. 268 
 269 
 270 
 271 
c. Taxonomy 272 
For the morphological analyzes we used the mature basidiomata of 47 Xylophallus 273 
specimens. Remarkable morphological differences were found on the basidiomata and in 274 
spore sizes of Xylophallus clavatus sp. nov. and Xylophallus xylogenus. On the other hand, no 275 
clear morphological distinctions were observed between Xylophallus xylogenus and the 276 
cryptic species. In this latter case, our assumption is exclusively based on the phylogenetic 277 
tree topology and the geographic distribution of the phylogenetic cryptic species. 278 
 279 
Xylophallus clavatus Cabral T.S., Baseia, I.G., Hosaka K., sp. nov. Fig. 4, 5. 280 
Mycobank: MB815135 281 
Etymology: in reference to basidiomata shape. 282 
Holotype: BRAZIL, Pará, Belterra, National Forest of the Tapajós (W54.92998 S2.94187), 29 283 
Mar 2014, T.S. Cabral & D.L. Komura (INPA 264901). DNA sequence data (GenBank 284 
44 
 
accession numbers): ITS = KU871795, rpb1 = KU871689, rpb2 = KU871723, Ef-1α = 285 
KU871513, gpd = KU871583. 286 
Diagnosis: Xylophallus clavatus has an immature basidiome with protuberances on the 287 
surface and rhizomorfs on the base. The mature basidiome has a clavate shape, up to 38 mm 288 
high; receptacle is campanulate with an umbilicated depression on the apex, the pseudostipe 289 
has reticulations that are deeper closer to the receptacle. Gleba is olive brown, with 290 
basidiospores 4.5–4.9 µm high. 291 
Description: Immature basidiome globose to subglobose, with protuberances on the surface, 292 
up to 8 × 6 mm, light brown (N40A99M20) on base to brown to the apex (N90A99M99), 293 
rhizomorphs on the base. Mature basidiome up to 38 × 7 mm in its thickest portion when 294 
fresh, clavate shape. Receptacle campanulate, smooth, with an umbilicated depression or 295 
minutely perforated at apex, adnate to pseudostipe, up to 6 × 7 mm. Pseudostipe up to 21 × 7 296 
mm, cylindrical, hollow, not attached to the volva, reticulated surface with reticulations 297 
deeper when closer to receptacle, white (N00A00M00), composed of ovoid to pyriform 298 
pseudoparenchymatous hyphae 20–35 × 20–27 µm, hyaline in 5 % KOH (same hyphae of 299 
receptacle). Volva light brown (N40A99M20) to brown (N90A99M99), with irregular 300 
dehiscence, rhizomorfs at base forming a net spreading through substrate, interconnecting 301 
basidiomes; external layer composed of filamentous hyphae 2.3–3.5 µm wide, hyaline in 5 % 302 
KOH, sinuous, septate and with clamp connections; internal gelatinous layer composed of 303 
pseudoparenchymatous hyphae 19–34 × 19–27 µm, hyaline in 5 % KOH. Rhizomorphs 304 
composed of filamentous hyphae, 1.5–3.6 µm wide, thick walled, septate, hyaline in 5 % 305 
KOH. Gleba olive brown (N99A50M10), gelatinous. Basidium clavate bearing 6–8 spores.306 
Basidiospores bacilar, smooth, 4.5–4.9 × 1.6–2.1 µm, greenish to hyaline in 5 % KOH. 307 
 308 
45 
 
Habitat and distribution: found on rotten wood, in the state of Amazonas (municipalities of 309 
São Gabriel da Cachoeira, São Paulo de Olivença, Maraã, Parintins and Barcelos) and Pará 310 
(Belterra), Brazil; and Costa Rica (Fig 1). 311 
Specimens examined: BRAZIL, Pará, Belterra, National Forest of Tapajós (W54.92998 312 
S2.94187), 25 Mar 2014, INPA 264900; 26 Mar 2014, INPA 264931; 30 Mar 2014, INPA 313 
264902, INPA 264903, INPA 264904, INPA 264905, INPA 264906, INPA 264932; 31 Mar 314 
2014, INPA 264933; Amazonas, São Paulo de Olivença, Monte Santo Community 315 
(W68.99939 S3.49752), 7 Feb 2014, T.S. Cabral & R. Braga-Neto, INPA 264893, INPA 316 
264894; Maraã, Sustainable Development Reserve Amanã (W64.62007 S2.48734), 14 Feb 317 
2014, T.S. Cabral & R. Braga-Neto, INPA 264896, INPA 264897, INPA 264898; São Gabriel 318 
da Cachoeira, Itacoatiara-Mirim Community (W66.97344 S0.12872), 6 May 2014, T.S. 319 
Cabral, INPA 264927; Parintins, Açaí Community, (W2.6475 S56.5484), 5 Feb 2015, T.S. 320 
Cabral, INPA 271636, INPA 271637, INPA 271638, INPA 271639, INPA 271640, INPA 321 
271641, INPA 271642, INPA 271643, INPA 271644, INPA 271645, INPA 271646, INPA 322 
271647; 6 Feb 2015, INPA 271648, INPA 271649, INPA 271650, INPA 271651, INPA 323 
271652; Barcelos, 11 Apr 2015, INPA 271654, INPA 271655. 324 
 325 
46 
 
 326 
Fig 4. Macromorphology of Xylophallus clavatus. (a, b) Fresh basidiomata; (c) dried 327 
basidiomata with a longitudinal cut through the volva, showing the pseudostipe not attached 328 
to it; (d) dried basidiomata showing a minutely perforated apex; (e, f) immature basidiomata 329 
with protuberances on surface. Photos: Tiara S. Cabral. 330 
 331 
47 
 
 332 
Fig 5. Micromorphology of Xylophallus clavatus. (a) Basidiospores; (b) basidium at the 333 
yellow arrow; (c) pseudoparenchymatous hyphae of pseudostipe; (d) filamentous hyphae from 334 
volva. 335 
 336 
Xylophallus xylogenus (Mont.) E. Fisch., in Engler & Prantl, Nat. Pflanzenfam., Edn 2 337 
(Leipzig) 7a: 96 (1933), [MB#223720] Fig. 6a-g. 338 
Basyonym: Phallus xylogenus Mont., Annales des Sciences Naturelles Botanique 3: 137, t. 339 
6:7 (1855) [MB#223720] 340 
Immature basidiome globose to subglobose, smooth and pruinose surface, up to 4 × 3 mm 341 
broad, light brown (N40A99M20) on base to brown to the apex (N90A99M99), rhizomorphs 342 
on the base. Mature basidiome up to 13 × 3 mm broad in its thickest portion when fresh. 343 
Receptacle campanulate, smooth, with an umbilicated depression or minutely perforated at 344 
apex, adnate to pseudostipe, 4.5 × 3 mm. Pseudostipe 4 × 2.5 mm, cylindrical, hollow, not 345 
48 
 
attached to the volva, reticulated surface with deep reticulations all over pseudostipe, white 346 
(N00A00M00), composed of ovoid to pyriform pseudoparenchymatous hyphae 17–40 × 17–347 
31 µm, hyaline in 5 % KOH (same hyphae of receptacle). Volva light brown (N40A99M20) 348 
to brown (N90A99M99), with irregular dehiscence, rhizomorfs at base forming a net 349 
spreading through substrate, interconnecting basidiomata; external layer composed of 350 
filamentous hyphae 2.1–3.2 µm wide, hyaline in 5 % KOH, sinuous, septate and with clamp 351 
connections; internal gelatinous layer composed of pseudoparenchymatous hyphae 15–26 × 352 
18–28 µm, hyaline in 5 % KOH. Rhizomorphs composed of filamentous hyphae, 1.5-3.6 µm 353 
wide, thick walled, septate, hyaline in 5 % KOH. Gleba olive brown (N99A50M10), 354 
gelatinous. Basidium clavate bearing 6–8 spores. Basidiospores bacilar, smooth, 3.9–4.4 × 355 
1.5–1.8 µm, greenish to hialine in 5 % KOH. 356 
 357 
Habitat and distribution: found on rotten wood. Xylophallus xylogenus sensu lato is known 358 
from French Guiana (Montagne 1855; Cheype 2010), French Antilles (Cheype 2010), 359 
Suriname (Fischer 1933), Brazil (Baseia et al. 2003), Peru and Ecuador (Gómez & Gazis 360 
2006). In this study we also found it in the state of Amazonas (municipalities of Tefé, Novo 361 
Airão, Manaus, Autazes and Presidente Figueiredo), Brazil (Fig 1), and these are the first 362 
records for Brazilian Amazonia. 363 
Additional specimens examined: BRAZIL, Amazonas, Careiro, Purupuru community 364 
(W59.712514 S3.394185), 7 Feb 2013, T.S. Cabral INPA 264875, INPA 264876, INPA 365 
264877; Presidente Figueiredo (W59.987902 S2.046274), 20 Jun 2013, T.S. Cabral INPA 366 
264889; Manaus, Botanical Garden (W59.947141 S3.008101), 7 Aug 2013, T.S. Cabral INPA 367 
264890; Ducke Reserve (W59.966424 S2.964135), 14 Jan 2014, T.S. Cabral INPA 264892; 368 
Novo Airão, São Sebastião Community (W60.47490 S2.82801), 12 Apr 2014, T.S. Cabral 369 
INPA 264907, INPA 264908, INPA 264909, INPA 264910; 13 Apr 2014, T.S. Cabral INPA 370 
49 
 
264911, INPA 264912, INPA 264935, INPA 264913, INPA 264914, INPA 264915; Centro 371 
de Integração e Aperfeiçoamento em Polícia Ambiental – CIAPA (W60.38326 S2.70825), 15 372 
Apr 2014, T.S. Cabral INPA 264916, INPA 264917, INPA 264918, INPA 264919, INPA 373 
264920, INPA 264921; 16 Apr 2014, T.S. Cabral INPA 264922, INPA 264923, INPA 374 
264924, INPA 264925; Tefé (W64.623400 S3.482733), 11 Mar 2015, T.S. Cabral INPA 375 
271653; Pernambuco, Recife, Trierveiler-Pereira URM 80262, URM 44245, URM 44244; 376 
Gurjaú, Estação Ecológica de Gurjaú (W35.569445 S8.597222), 28 Jun 2002, Baseia, I.G.; 377 
Gibertoni, T.B.; UFRN-Fungos 458, as Phallus pygmaeus. FRANCE, French Guiana, Rémire-378 
Montjoly (W52.286944 N4.93925), 13 Mar 2013, T.S. Cabral INPA 264878. 379 
Additional specimens examined from the cryptic species: BRAZIL, Amazonas, Humaitá, Road 380 
to Ipixuna (W063,11626 S07,57440), 4 Apr 2013, T.S. Cabral & R. Braga-Neto INPA 381 
264879; Barreira do Tambaqui Community (W062,88771 S07,85109), 5 Apr 2013, T.S. 382 
Cabral & R. Braga-Neto INPA 264880; Acará Lake - Terra Preta Community (W062,42154 383 
S06,37516), 8 Apr 2013, T.S. Cabral & R. Braga-Neto INPA 264881; Acará Lake – São 384 
Francisco Community (W062,45149 S06,35173), 9 Apr 2013 T.S. Cabral & R. Braga-Neto 385 
INPA 264882; Manicoré, Barro Alto Community (W061,48618 S05,97782), 11 Apr 2013, 386 
T.S. Cabral & R. Braga-Neto INPA 264883; Jatuarana Lake - Castanhal do Galeno 387 
(W061,43864 S05,73451), 12 Apr 2013, T.S. Cabral & R. Braga-Neto INPA 264884; Boca 388 
do Rio Community (W061,32956 S05,87370), 13 Apr 2013, T.S. Cabral & R. Braga-Neto 389 
INPA 264885, INPA 264886; Novo Aripuanã, São Félix Community, 16 Apr 2013, T.S. 390 
Cabral & R. Braga-Neto INPA 264887, INPA 264888. 391 
50 
 
 392 
Fig 6. Xylophallus xylogenus. (a, b) Fresh mature basidiomata; (c) Immature basidiomata 393 
fresh and (d) dried showing the smooth surface; (e) basidiospores; (f) pseudoparenchymatous 394 
51 
 
hyphae of pseudostipe; (g) clavate basidia; (h) a representative of the Xylophallus cryptic 395 
species. Photos a-g: Tiara S. Cabral; h: Ricardo Braga Neto. 396 
 397 
4. Discussion 398 
This study aimed to investigate infrageneric diversity of Xylophallus through 399 
morphological and molecular phylogenetic methods. The results reveal the presence of three 400 
evolutionary units belonging to the genus. One is the known species X. xylogenus, and 401 
another corresponds to a morphologically different and new species in the genus, named 402 
Xylophallus clavatus. A third clade can also be distinguished by the ITS rDNA marker, with 403 
geographic distribution restricted to the lower Madeira River basin, although specimens of 404 
this clade are morphologically identical to X. xylogenus. 405 
The morphological analysis revealed two different morphospecies, with one 406 
corresponding to X. xylogenus. Although the nomenclatural history of X. xylogenus is quite 407 
confusing (see Trierveiler-Pereira & da Silveira (2012) for details), this is a valid name, 408 
following the InternationalCode of Nomenclature for Algae, Fungi, and Plants. Since the 409 
holotype is from Cayenne, French Guiana (Montagne 1855), and in our study the specimen 410 
from this type locality clustered in the red clade (Fig 3, Fig S1 and S2), we believe that this 411 
clade corresponds to Xylophallus xylogenus sensu lato. In fact, comparisons between 412 
specimens of X. xylogenus obtained in this study and those published earlier (Cheype 2010; 413 
Trierveiler-Pereira & da Silveira 2012; Baseia et al. 2003; Fischer 1898) confirm that they all 414 
belong to the same species, with a congruence between morphological characters and 415 
geographic distribution. Cheype (2010) proposed the synonymy of Phallus pygmaeus to 416 
Xylophallus xylogenus, which was sustained by Trierveiler-Pereira & da Silveira (2012). In 417 
our analysis we also included specimens from the Atlantic rainforest published as Phallus 418 
52 
 
pygmaeus (Baseia et al. 2003), and they clustered in the X. xylogenus clade (Fig S1 and S2), 419 
which confirms that both taxa belong to the same species. 420 
The second morphospecies is new to science, named Xylophallus clavatus. It is 421 
macroscopically characterized by its larger basidiomata size, the immature basidiomata 422 
surface with protuberances, the clavate shape of the mature basidiomata and the pseudoestipe 423 
formed by relatively shallow reticulations (Fig 4). On the other hand, X. xylogenus is smaller, 424 
the immature basidiomata has a smooth surface, the mature basidiomata is fusiform, and the 425 
pseudostipe is formed by deeper reticulations (Fig 6). Microscopically, they differ mainly by 426 
basidiospore sizes: in X. clavatus the basidiospores are 4.5-4.9 µm in length, while in X. 427 
xylogenus basidiospores are 3.9-4.4 µm (Figs 5 and 6). Sáenz et al. (1972) provided a very 428 
detailed description of specimens from Costa Rica. In our analysis, the Costa Rican specimen 429 
grouped in the new species clade. We found morphological similarities between the author’s 430 
description and the specimens of X. clavatus analyzed here, such as mature and immature 431 
basidiomata sizes, immature basidiomata surface with protuberances and basidiospore sizes. 432 
In fact, the authors claim that their results are somewhat different from those previously 433 
published, which now can be explained since previous papers were dealing with X. xylogenus 434 
sensu lato. 435 
We could detect no noticeable differences in morphological characters and ecology 436 
between X. xylogenus and the third clade (green on Fig 3), which corresponds to a cryptic 437 
species. So far, the only noticeable difference between these two species is their distributions. 438 
X. xylogenus can be found both in the Atlantic and Amazon forests, while the cryptic species 439 
seems to be restricted to the lower Madeira River basin in the Amazon forest domain. 440 
Bickford et al. (2007) consider kingdom Fungi as a group with high probabilities of harboring 441 
cryptic species. Indeed, several examples of cryptic speciation in Fungi can be found in the 442 
literature with many of them in Basidiomycota (Ramirez-Lopez et al. 2015; Sheedy et al. 443 
53 
 
2013; Harder et al. 2013; Stefani et al. 2014; Geml et al. 2006), but the present one is the first 444 
example of a cryptic species in phalloid fungi recorded to date. The discovery of cryptic 445 
diversity in fungi has significance in species and habitat conservation, and this specific case 446 
shows the importance of studying little-studied taxa and under-sampled areas. In addition to 447 
the already known X. xylogenus, a new species and a cryptic one were found, all endemic to 448 
Neotropical forests, more specifically to old-growth dense forests. The destruction of habitats 449 
caused by deforestation could lead to the loss of the Neotropical fungal species yet to be 450 
discovered, especially those with very specific habitats. Therefore, more efforts should be 451 
spent to study the mycobiota of Neotropical forests so that conservation programs can take 452 
into account the existence of this so far hidden fungal diversity. 453 
DNA barcode methodology is an elucidative tool for taxonomists. There are two different 454 
goals when using DNA barcodes: species identification, when the goal is to assign a name to 455 
an unknown specimen using DNA data from correctly identified species; and species 456 
discovery, when the goal is to sort collections into species-like units (Schindel & Miller 2005; 457 
Collins & Cruickshank 2013). One of our aims in this study was to investigate the resolution 458 
power of the barcoding methodology in our dataset, which could be used to avoid 459 
misidentification of specimens collected in the future. The threshold optimization approach 460 
showed only false negative and positive identifications for all genes used herein, which means 461 
that these genes did not present a clear barcoding gap (Brown et al. 2012). Several reasons 462 
can be suggested for the lack of a barcoding gap, such as incorrect taxonomy, hybridization, 463 
radiation and incomplete lineage sorting (Pino-Bodas et al. 2013). Considering the recent 464 
speciation in Xylophallus, as evidenced by the short branch lengths, the lack of a barcoding 465 
gap can be explained by incomplete lineage sorting of the gene sequences analyzed, which 466 
can also explain the inconsistency between gene trees and species trees (van Velzen et al. 467 
2012). Schoch et al. (2012) tested 6 DNA regions and showed that the nuclear ribosomal 468 
54 
 
internal transcribed spacer (ITS) was the most suitable region for species delimitation in 469 
Fungi, but the authors acknowledge that supplementary barcodes can be developed for 470 
specific cases. In fact, there are several studies demonstrating that ITS by itself might fail to 471 
delimitate species in some fungi (Pino-Bodas et al. 2013; Bellanger et al. 2015; Li et al. 2013; 472 
Lücking et al. 2014; Lindner & Banik 2011), just as it fails to define boundaries between the 473 
Xylophallus species based on genetic distance. The lack of a barcoding gap for each gene 474 
makes it impossible to define a threshold for delimiting species in Xylophallus; therefore an 475 
alternative methodology that is not based on genetic distances was used. 476 
Using independently evolving markers in a species tree approach with selection of the best 477 
model of species delimitation using Bayes factors seems to be useful in understanding the 478 
evolutionary history in Xylophallus. This method of coalescent-based species delimitation 479 
was recently proposed and estimates marginal likelihoods for each competing model, from 480 
which Bayes factors are calculated and compared (Grummer et al. 2014). Although this 481 
method can test only a limited number of hypotheses (Yang & Rannala 2014), it still has great 482 
advantages, like the ability to compare models with different numbers of species or different 483 
assignments of individuals to species. In our dataset, the species delimitation model of three 484 
species was selected over the model of two species, partially agreeing with morphological 485 
data and fully with geographical data. In the same way, Bryson et al. (2014) were able to 486 
delimit species in a group of snakes using model selection with Bayes factors, where two 487 
groups were recognized as new species in concordance with morphological data. This 488 
methodology is elucidative using either DNA sequences or genome-wide SNP data (Leaché et 489 
al. 2014), indicating that it can be a promising method for species delimitation based on 490 
multiple loci data. 491 
The species tree inferred indicates that the previous taxonomy of Xylophallus does not 492 
reflect its evolutionary history. This genus is actually composed of at least three species, 493 
55 
 
where X. xylogenus is a sister species of a crypticspecies, and X. clavatus is a sister clade of 494 
these two. The cryptic species shares the same morphological characters with X. xylogenus, 495 
probably because of its recent speciation. On the other hand, the speciation between X. 496 
xylogenus and X. clavatus is older, so morphological differences accumulated over time. 497 
Although it seems to be a true species, we have decided to not provide a description of the 498 
cryptic species using the available data, until more specimens can be added for future 499 
analysis. 500 
The speciation event that gave rise to X. clavatus and X. xylogenus is older than the split 501 
between the latter and the cryptic species. Since it is not possible to reliably date the 502 
phylogenetic trees, it is hard to infer the most probable geological scenario in which this 503 
speciation may have occurred. Still, the lower Madeira River basin might have played an 504 
important role in the speciation between Xylophallus cryptic species and X. xylogenus, since 505 
the cryptic species is so far restricted to that area. The distribution of Xylophallus cryptic 506 
species is on both sides of Madeira River and no other large river seems to be a barrier for 507 
other Xylophallus species’ distributions. Given the statimospory nature of Xylophallus spore 508 
liberation, its dependence on insects for dispersal and the lack of barriers due to major rivers, 509 
we do not yet have a hypothesis to explain the divergence of the cryptic species from X. 510 
xylogenus sensu lato. 511 
 512 
5. Conclusions 513 
The species tree allied with methods of species delimitation and morphological data 514 
analyses provide strong evidence for the existence of more than one species in the genus 515 
Xylophallus. Besides the already known X. xylogenus, this genus harbors a new species 516 
named X. clavatus, and a third cryptic species with a very restricted geographic distribution. 517 
We provide enough morphological characters to differentiate the newly described species, but 518 
56 
 
we have decided to not formally describe the cryptic species until more collections from un-519 
sampled areas are available. All four genes show the same phylogenetic history with the 520 
presence of two species, but the ITS region shows the existence of a third species. This 521 
difference certainly reflects the lower mutation rates of the protein coding genes. Due to the 522 
recent diversification, it was not possible to delimit species in the genus based only on genetic 523 
distances of the five DNA regions used in this paper, so a method of species delimitation 524 
model selection was used. This shows the importance of testing different DNA regions along 525 
with the ITS region, the proposed barcode for fungi, and to test alternative methods of species 526 
delimitation. This study demonstrates the importance of studying fungal diversity of 527 
Neotropical forests. 528 
 529 
Acknowledgments 530 
We thank Dr. Doriane Picanço Rodrigues for coordination of the Laboratory of Applied 531 
Evolution at Federal University of Amazonas, where part of the molecular data were obtained. 532 
We thank Dr. Rupert Collins for his insights on species delimitation methods, and Ricardo 533 
Braga Neto and Dirce Leimi Komura for collecting support. We are extremely grateful for all 534 
residents of the communities visited along the rivers of the Amazon basin, who supported us 535 
on field trips. 536 
 537 
References 538 
Agapow, P.M. et al., 2004. The Impact of Species Concept on Biodiversity Studies. The 539 
Quarterly Review of Biology, 79(2), pp.161–179. 540 
Anon, IBGE – Instituto Brasileiro de Geografia e Estatística. Available at: 541 
http://www.ibge.gov.br [Accessed April 5, 2016]. 542 
Arnold, A.E. & Lutzoni, F., 2007. Diversity and Host Range of Foliar Fungal Endophytes: are 543 
tropical leaves biodiversity hotspots? Ecology, 88(3), pp.541–549. 544 
Baseia, I.G. & Calonge, F.D., 2005. Aseroë floriformis, a new phalloid with a sunflower-545 
57 
 
shaped receptacle. Mycotaxon, 92, pp.169–172. 546 
Baseia, I.G., Gibertoni, T.B. & Maia, L.C., 2003. Phallus pygmaeus, a new minute species 547 
from a Brazilian Tropical Rainforest. Mycotaxon, 85, pp.77–79. 548 
Baseia, I.G., Maia, L.C. & Calonge, 2006. Notes on Phallales in the Neotropics. Boletin de la 549 
Sociedad Micologica de Madrid, 30, pp.87–93. 550 
Begerow, D. et al., 2010. Current state and perspectives of fungal DNA barcoding and rapid 551 
identification procedures. Applied microbiology and biotechnology, 87(1), pp.99–108. 552 
Begerow, D., Stoll, M. & Bauer, R., 2006. A phylogenetic hypothesis of Ustilaginomycotina 553 
based on multiple gene analyses and morphological data. Mycologia, 98(6), pp.906–916. 554 
Bellanger, J.-M. et al., 2015. Plunging hands into the mushroom jar: a phylogenetic 555 
framework for Lyophyllaceae (Agaricales, Basidiomycota), 556 
Bickford, D. et al., 2007. Cryptic species as a window on diversity and conservation. Trends 557 
in Ecology & Evolution, 22(3), pp.148–155. 558 
Brown, S.D.J. et al., 2012. Spider: an R package for the analysis of species identity and 559 
evolution, with particular reference to DNA barcoding. Molecular ecology resources, 560 
12(3), pp.562–5. 561 
Bryson, R.W. et al., 2014. Multilocus species delimitation in the Crotalus triseriatus species 562 
group (Serpentes: Viperidae: Crotalinae), with the description of two new species. 563 
Zootaxa, 3826(3), pp.475–496. 564 
Cabral, T.S. et al., 2012. Abrachium, a new genus in the Clathraceae, and Itajahya reassessed. 565 
Mycotaxon, 119, pp.419–429. 566 
Calonge, F.D., 2005. A tentative key to identify the species of Phallus. Boletin de la Sociedad 567 
Micologica de Madrid, 29, pp.9–18. 568 
Calonge, F.D. & Kreisel, H., 2002. Phallus minusculus sp. nova from Tropical Africa. Feddes 569 
Repertorium, 113, pp.600–602. 570 
Calonge, F.D., Kreisel, H. & Mata, M., 2005. Phallus atrovolvatus, a new species from Costa 571 
Rica. Boletin de la Sociedad Micologica de Madrid, 29, pp.5–8. 572 
Calonge, F.D., Mata, M. & Carranza, J., 2005. Contribución al catálogo de los 573 
Gasteromycetes (Basidiomycotina, Fungi) de Costa Rica. Anales del Jardín Botánico de 574 
Madrid, 62(1), pp.23–45. 575 
Cheype, J., 2010. Phallaceae et Clathrus récoltés en Guyane Française. Bulletin Mycologique 576 
et Botanique Dauphiné-Savoie, 66, pp.51–66. 577 
Coker, W.C. & Couch, J.N., 1928. The Gasteromycetes of the Eastern United States and 578 
Canada, 579 
Collins, R. a. & Cruickshank, R.H., 2013. The seven deadly sins of DNA barcoding. 580 
Molecular Ecology Resources, 13(6), pp.969–975. 581 
Cortez, V.G., Baseia, I.G. & da Silveira, R.M.B., 2011. Two noteworthy Phallus from 582 
southern Brazil. Mycoscience, 52, pp.436–438. 583 
Courtecuisse, R., 2008. Current trends and perspectives for the global conservation of fungi. 584 
In D. Moore et al., eds. Fungal conservation: issues and solutions. New York: 585 
Cambridge University Press, pp. 7–18. 586 
Cunningham, G.H., 1944. The Gasteromycetes of Australia and New Zealand, Dunedin: 587 
McIndoe. 588 
58 
 
Dahlberg, A., Genney, D.R. & Heilmann-Clausen, J., 2010. Developing a comprehensive 589 
strategy for fungal conservation in Europe: current status and future needs. Fungal 590 
Ecology, 3(2), pp.50–64. 591 
Dahlberg, A. & Mueller, G.M., 2011. Applying IUCN red-listing criteria for assessing and 592 
reporting on the conservation status of fungal species. Fungal Ecology, 4(2), pp.147–593 
162. 594 
Darriba, D. et al., 2012. jModelTest 2: more models, new heuristics and parallel computing. 595 
Nature Methods, 9(8), p.772. 596 
Das, K., Singhi, S.K. & Calonge, F.D., 2007. Gasteromycetes of western Ghats, india: I. a 597 
new form of Phallus Indusiatus. Boletin de la Sociedad Micologica de Madrid, 31, 598 
pp.135–138. 599 
Davis, C.C. et al., 2014. Long-term morphological stasis maintained by a plant-pollinator 600 
mutualism.