Buscar

ImplantaçãoeAvaliaçãoPreliminarDeDoisProtocolosDeExtraçãoDeRNAViral_Araujo_2023

Prévia do material em texto

UNIVERSIDADE FEDERAL DO RIO GRANDE DO NORTE 
CENTRO DE BIOCIÊNCIAS 
CURSO DE CIÊNCIAS BIOLÓGICAS 
 
 
 
 
 
 
RENATA SOPHIA CAVALCANTI ARAÚJO 
 
 
 
 
 
 
 
 
IMPLANTAÇÃO E AVALIAÇÃO PRELIMINAR DE DOIS PROTOCOLOS DE 
EXTRAÇÃO DE RNA VIRAL 
 
 
 
 
 
 
NATAL/RN 
2023 
 
 
RENATA SOPHIA CAVALCANTI ARAÚJO 
 
 
 
 
 
 
IMPLANTAÇÃO E AVALIAÇÃO PRELIMINAR DE DOIS PROTOCOLOS DE 
EXTRAÇÃO DE RNA VIRAL 
 
 
 
 
 
Monografia apresentada ao curso de 
graduação em Ciências Biológicas, da 
Universidade Federal do Rio Grande do 
Norte, como requisito parcial à obtenção 
do título de Bacharel em Ciências 
Biológicas 
 
Orientador: Prof. Dr. Josélio Maria Galvão 
de Araújo. 
 
 
 
 
 
 
 
 
 
 
 
 
 
NATAL/RN 
2023 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 Universidade Federal do Rio Grande do Norte - UFRN 
Sistema de Bibliotecas - SISBI 
Catalogação de Publicação na Fonte. UFRN - Biblioteca Central Zila Mamede 
 
 Araujo, Renata Sophia Cavalcanti. 
 Implantação E Avaliação Preliminar De Dois Protocolos De 
Extração De RNA Viral / Renata Sophia Cavalcanti Araujo. - 2023. 
 44 f.: il. 
 
 Monografia (graduação) - Universidade Federal do Rio Grande do 
Norte, Centro de Biociências, Curso de Ciências Biológicas, 
Natal, RN, 2023. 
 Orientador: Prof. Dr. Josélio Maria Galvão de Araújo. 
 
 
 1. Extração de RNA viral - Monografia. 2. CHIKV - Monografia. 
3. Diagnóstico - Monografia. 4. Arboviroses - Monografia. 5. RT-
qPCR - Monografia. I. Araújo, Josélio Maria Galvão de. II. 
Título. 
 
RN/UF/BCZM CDU 577.2 
 
 
 
 
 
Elaborado por Ana Cristina Cavalcanti Tinoco - CRB-15/262 
 
 
 
RENATA SOPHIA CAVALCANTI ARAÚJO 
 
 
 
IMPLANTAÇÃO E AVALIAÇÃO PRELIMINAR DE DOIS PROTOCOLOS DE 
EXTRAÇÃO DE RNA VIRAL 
 
 
Monografia apresentada ao curso de 
graduação em Ciências Biológicas, da 
Universidade Federal do Rio Grande do 
Norte, como requisito parcial à obtenção 
do título de Bacharel em Ciências 
Biológicas. 
 
 
 
Aprovada em: 13/07/2023 
 
BANCA EXAMINADORA 
 
 
Prof. Dr. Josélio Maria Galvão de Araújo 
Orientador(a) 
UNIVERSIDADE FEDERAL DO RIO GRANDE DO NORTE 
 
 
Prof. Dr. José Veríssimo Fernandes 
Membro interno 
UNIVERSIDADE FEDERAL DO RIO GRANDE DO NORTE 
 
 
Prof(a). Dr(a). Joanna Gardel Valverde Galvão 
Membro externo 
INSTITUTO DE MEDICINA TROPICAL 
 
 
 
 
Prof(a). Dr(a). Hannaly Wana Bezerra Pereira 
Membro suplente 
UNIVERSIDADE POTIGUAR 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
À Deus, por sempre me acompanhar. Ao 
meu orientador, a minha família e aos 
meus amigos, tudo isso eu consegui 
porquê vocês estavam aqui. 
 
 
 
 
AGRADECIMENTOS 
 
Agradeço à Deus pelo dom da vida e por proporcionar infindáveis bençãos em 
minha vida. Sem Ele eu nada seria. Mesmo nos momentos mais complicados Ele 
nunca soltou minha mão. 
Aos meus pais Ester, Renato e à minha princesinha Viviane. Sou infinitamente 
grata por todo apoio, carinho, companheirismo, e principalmente paciência nessa 
jornada acadêmica em que houve tantos altos e baixos. Obrigada por serem a melhor 
família que alguém poderia ter, por cuidarem tão bem de mim e sempre me ensinarem 
a ser uma versão melhor de mim, amo vocês de todo meu coração. 
Agradeço à minha avó que sempre está disposta a ajudar e acolher, te amo 
enorme, vó! Agradeço também aos meus primos Débora, Gabriel e Victor por sempre 
estarem presentes em vários momentos da minha vida. Agradeço a Deus por esse 
vínculo tão precioso que nós temos. 
Ao meu orientador Josélio Araújo, em primeiro lugar por ser um exemplo de 
pessoa dentro e fora da Universidade. Agradeço imensamente por poder fazer parte 
de um grupo de pesquisa tão rico e acolhedor, além de poder contribuir um pouco 
mais com o trabalho que fazemos por lá. Sou grata pelo conhecimento que o senhor 
sempre faz questão de transmitir, a paciência que tem de lidar com todas as questões 
que aparecem, fazem com que o ambiente acadêmico se torne mais humano. O 
senhor faz questão de mostrar que a ciência deve sim ser pra todos, e isso é incrível. 
Obrigada por tudo! 
Agradeço aos meus companheiros de luta do laboratório que sempre estiveram 
a postos para qualquer imprevisto que acontecia. Obrigada Dudinha por sempre me 
ajudar e muito mais que isso, me incentivar com os projetos, me acolher no laboratório 
e me ensinar tanta coisa que eu aprendi, mesmo que em um curto período. Edson e 
Júnior, obrigada por serem companhias incríveis, sempre dispostos a trabalhar, a dar 
risadas, contar histórias mirabolantes, e tornar o ambiente do laboratório ainda mais 
leve. O LADIC me mostrou que a ciência não precisa ser uma guerra de egos. 
Agradeço ao meu chaveirinho Gabrielle por ter estado comigo todos os dias 
desses anos de graduação. Obrigada, amig(f)a, por estar sempre ao meu lado para 
 
 
os dias bons, ruins, para os açaís, lanches do setor 3 e matérias optativas. Sem você 
o curso teria sido menos divertido. 
Agradeço a todos os amigos que fiz ao longo do curso por terem sido 
maravilhosos nesse caminho acadêmico. 
Agradeço ao meu grupo fantástico de amigas que me alegram desde o ensino 
fundamental. Luiza, Pâmela, Renata e Yasmin, vocês têm um espacinho especial no 
meu coração. Obrigada por sempre me tirarem as risadas mais sinceras, pelos 
encontros que acontecem de mês em mês e por serem um sol brilhante em minha 
vida. Tenho tanto a agradecer a vocês, mas se eu falar mais vai encher umas 3 
páginas. 
Agradeço à minha irmã carioca Amanda que mesmo longe sempre esteve 
presente pra me ajudar com meus surtos e alegrias. Obrigada, irmã, você é muito 
especial para mim, vivo com saudade de você. 
Agradeço às minhas amigas Isabella e Yasmin por estarem sempre comigo 
quando eu mais preciso, obrigada pelos conselhos mais sensatos e abraços sinceros. 
Sei que quando preciso de um sacode, são vocês que vêm para me acudirem. 
Obrigada por tudo. 
Agradeço aos professores José Verissimo, Joanna Galvão e Hannaly Wana por 
terem aceitado o convite para a banca desse TCC. 
Agradeço ao CNPq pela bolsa concedida durante meu período como IC no 
laboratório. 
Agradeço a todos que me ajudaram direta ou indiretamente nesse período, 
vocês foram muito importantes para minha jornada e a conclusão desse trabalho. 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
Existem coisas melhores adiante do que qualquer outra que 
deixamos para trás. 
— C. S. Lewis 
 
A ciência e a vida cotidiana não podem e não devem ser 
separadas. 
— Rosalind Franklin 
 
 
 
Resumo 
O vírus Chikungunya (CHIKV) pertence à família Togaviridae, classificado 
epidemiologicamente como arbovírus por ser transmitido por mosquitos. As 
arboviroses podem se assemelhar no período inicial da infecção, porém suas 
consequências são distintas, como no caso do CHIKV, o qual provoca inflamações 
articulares. Essas questões fazem com que esse vírus tenha uma grande atenção da 
saúde pública pois já provocou epidemias em várias regiões do mundo. Para que haja, 
então, a correta identificação viral são necessários exames laboratoriais que 
confirmem os resultados de forma precisa. Um deles é o RT-qPCR, um exame rápido 
e de alta sensibilidade que vem sendo usado mais frequentemente para fase aguda 
da doença. No entanto, esse exame, por ter um custo mais alto, não está disponível 
para ser realizado em todos os laboratórios, o que acaba tornando uma dificuldade 
para o diagnóstico e monitoramento da doença. Esse custo é advindo principalmente 
dos kits de extração utilizados, os quais também podem ser de difícil execução, caso 
não haja o material necessário. Nesse contexto, o foco do presente trabalho foi de 
avaliar a eficácia de kits de extraçãoe detecção dos vírus a partir do RT-qPCR, e 
compará-los para que houvesse a redução de custo dos diagnósticos. Foram 
estudados 14 casos suspeitos de arbovírus, sendo 10 suspeitos de Chikungunya. 
Todas as amostras foram extraídas e purificadas através de dois kits, BioGene 
(QUIBASA, Inc., Minas Gerais, Brasil) e QIAamp Viral RNA Mini Kit (250) (QIAGEN, 
Inc., Valencia, EUA). Após a extração, foi avaliada a qualidade e a quantidade do RNA 
viral. Nesse sentido, foi utilizado o método de RT-qPCR. Adicionalmente, foi realizada 
a análise de custo do material. O kit BioGene obteve os melhores resultados na 
comparação entre os dois protocolos avaliados, com valores de Cycle Threshold (Ct) 
menor, indicando um maior rendimento do teste. Além disso, o custo do protocolo 
implementado a partir do kit da BioGene foi 44% menor que o da Qiagen. 
 
Palavras Chave: Extração de RNA viral; CHIKV; Diagnóstico; Arboviroses; RT-qPCR. 
 
 
 
ABSTRACT 
 
The Chikungunya virus (CHIKV) belongs to the Togaviridae family, classified 
epidemiologically as an arbovirus, transmitted by mosquitoes. Arboviruses can show 
similar symptoms in the initial period of infection, but their outcome are different. The 
Chikungunya fever, for example, causes arthritis. These issues mean that this virus 
has a great deal of public health attention, as it has already caused epidemics in 
different regions of the world. Therefore, for correct viral identification, laboratory tests 
are necessary to confirm the results accurately. One of these is RT-qPCR, a fast, high-
sensitivity test that is being used more frequently for diagnoses. However, this test, 
due to its higher cost, is not available to be performed in all laboratories, which ends 
up making it difficult to diagnose and monitor the disease. This cost comes mainly from 
the kits used, which can also be difficult to implement if the necessary material is not 
available. In this context, the aim of the present work was to evaluate the effectiveness 
of virus detection and detection kits based on RT-qPCR, and compare them so that 
there was a reduction in the cost of diagnoses. Fourteen suspected cases of arbovirus 
were studied, ten of which were suspected of Chikungunya fever. All samples were 
extracted and purified using two kits, BioGene (QUIBASA, Inc., Minas Gerais, Brazil) 
and QIAamp Viral RNA Mini Kit (250) (QIAGEN, Inc., Valencia, USA). Next, the quality 
and quantity of the viral RNA was evaluated. For this, the RT-qPCR method was used. 
In addition, a material cost analysis was performed. The analysis showed that the 
BioGene kit obtained the best results in the comparison between the two evaluated 
protocols, with lower Cycle Threshold (Ct) values, indicating a higher test yield. In 
addition, the cost of the protocol implemented from the BioGene kit was 44% lower 
than Qiagen. 
 
Keywords: Viral RNA extraction, CHIKV; Diagnosis; Arboviruses; RT-qPCR. 
 
 
 
 
 
 
LISTA DE FIGURAS 
Figura 1 – Microscopia do vírus Chikungunya........................................................... 17 
Figura 2 – Ilustração de estrutura Viral do vírus Chikungunya .................................. 18 
Figura 3 – Representação do genoma do vírus Chikungunya .................................. 19 
Figura 4 – Ação da sonda TaqMan (Applied Biosystems™) na RT-qPCR ................ 24 
Figura 5 – Gráfico demonstrativo da RT-qPCR ......................................................... 25 
Figura 6 – Manejo para diagnóstico de paciente suspeito de Chikungunya. ............. 28 
 
 
 
 
LISTA DE GRÁFICOS 
Gráfico 1 – RT-qPCR para análise de amostras de pacientes infectados pelo vírus 
Chikungunya (CHIKV). .............................................................................................. 36 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
LISTA DE TABELAS 
Tabela 1 – Tabela 1: Oligonucleotídeos utilizados na reação para a RT-qPCR........ 33 
Tabela 2 – Lista de reagente para a reação de RT-qPCR. ....................................... 33 
Tabela 3 – Parâmetros de termociclagem. ................................................................ 34 
Tabela 4 – Resultado da RT-qPCR. .......................................................................... 35 
Tabela 5 – Avaliação de custo kit/amostra. ............................................................... 37 
 
SUMÁRIO 
1 INTRODUÇÃO .................................................................................................... 16 
1.1 Classificação do agente etiológico ............................................................... 16 
1.2 Estrutura Viral .............................................................................................. 16 
1.3 Estrutura do Genoma Viral e Patogênese .................................................... 18 
1.4 Manifestações Clinicas ................................................................................. 20 
1.5 Diagnóstico .................................................................................................. 22 
1.5.1 RT-qPCR (PCR quantitativo em tempo real com transcrição reversa) .. 23 
1.6 Epidemiologia do vírus Chikungunya e Prevenção ...................................... 25 
2 OBJETIVOS ........................................................................................................ 29 
1.1 Objetivo Geral .............................................................................................. 29 
2.1 Objetivos específicos ................................................................................... 29 
3 MATERIAIS E MÉTODOS .................................................................................. 30 
3.1 Local de estudo ............................................................................................ 30 
3.2 Amostras biológicas analisadas ................................................................... 30 
3.3 Diagnóstico molecular do vírus Chikungunya .............................................. 30 
3.3.1 Extração e Purificação do RNA viral ...................................................... 30 
3.3.2 RT-qPCR (Transcriptase Reversa seguida da Reação de Cadeia de 
Polimerase em tempo real) ................................................................................. 32 
3.4 Custo benefício dos kits. .............................................................................. 34 
3.5 Aspectos éticos. ........................................................................................... 34 
4 Resultados e discussão ...................................................................................... 35 
4.1 PCR em tempo real (RT-qPCR) ................................................................... 35 
4.2 Relação custo benefício ............................................................................... 37 
5 Conclusão ........................................................................................................... 39 
16 
 
1 INTRODUÇÃO 
1.1 Classificação do agente etiológico 
 
A família Togaviridae engloba dois genêros, o Rubivirus, causador da rubéola, 
e o Alphavirus, que abrange 29 espécies de arbovírus classificados em 7 complexos 
com determinantes antigênicos. O vírus Chikungunya (CHIKV) pertence ao complexo 
Semliki Forest (SF), no qual estão presentes outros vírus, como o O'NYONG-NYONG 
(ONN), Ross River (RRV) e o Mayaro (MAYV) (POWERS, 2010). Os vírus desse grupo 
são denominados Alphavirus do Velho Mundo, e são capazes de provocar febre, 
erupções cutâneas e artralgia, diferenciando-se daqueles classificados como do Novo 
Mundo, os quais causam encefalite (SOLIGNAT et al., 2009). 
Apesar de apresentar apenas um sorotipo, o CHIKV possui alguns genótipos 
descritos, que foram desenvolvidos a partir de surtos espalhados por diferentes 
regiões geográficas: Asiático, Leste-Centro-Sul Africano, Oeste Africano e OceanoIndico. O surgimento dos primeiros casos da febre Chikungunya data de 1952, quando 
o vírus foi isolado pela primeira vez por em Newala, Tânzania, no continente africano 
(NUNES et al., 2015; ROSS, 1956; WEAVER, 2014). 
A transmissão do CHIKV se dá pela picada do mosquito fêmea infectado, das 
espécies Aedes aegypti e Aedes albopictus, o que faz da doença ser considerada uma 
arbovirose (HIGGSSTEPHEN; VANLANDINGHAMDANA, 2015). 
 
1.2 Estrutura Viral 
 
O vírus Chikungunya, tal qual os demais Alphavirus, possui RNA de fita 
simples, com tamanho aproximado 11.5-kb., polaridade positiva e tem uma estrutura 
esférica de 70nm, composta de nucleocapsídeo e envelope (JOSE; SNYDER; KUHN, 
2009; RUPP et al., 2015) (Figura 1). 
O envelope viral é constituído de uma bicamada fosfolipídica, em que os 
componentes são derivados da membrana plasmática da célula hospedeira 
(STRAUSS; STRAUSS, 1994). 
 
 
 
17 
 
Figura 1 – Microscopia do vírus Chikungunya. 
 
Fonte: Adaptado de Weaver et. al., 2015. 
Legenda: Representação do vírion maduro em “A”, estruturas em “B”, e proteínas 
estruturais em “C”. 
 
As glicoproteínas E1 e E2 fazem parte do envelope viral, que se agrupam em 
três unidades e formam um heterodímero de morfologia semelhante a um espinho ou 
espícula (spike), o qual auxilia o vírus na entrada da célula. A formação das espículas 
se dá através da codificação de proteínas estruturais traduzidas do RNA viral, que ao 
se juntarem, formam um trímero de proteínas E1 e E2, somando o total de 80 
estruturas (CHO et al., 2008; VOGEL et al., 1986) (Figura 2). 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
18 
 
Figura 2 - Ilustração de estrutura Viral do vírus Chikungunya. 
 
 
Fonte: Adaptado de ViralZone (SIB Swiss Institute of Bioinformatics). 
Legenda: Em “A” é possível ver a constituição do vírion maduro, com o RNA genômico 
envolto pela proteína C (capsídeo), a membrana protetora do núcleocapsídeo e as 
espículas inseridas. Já em “B”, observa-se o vírion pelo exterior, com o capsídeo se 
simetria icosaedrica, formado por um agrupamento de 4 trímeros de proteínas 
estruturais. 
 
 
1.3 Estrutura do Genoma Viral e Patogênese 
 
O genoma do Vírus Chikungunya é um RNA de fita simples, polaridade 
positiva, com aproximadamente 11.2 kilobases, e 12 mil nucleotídeos, com um cap na 
extremidade 5’ e uma cauda poli A na extremidade 3’ (5′ cap-nsP1-nsP2nsP3-nsP4-
(junction region)-C-E3-E2-6k-E1-poly(A)-3′) (SINGH et al., 2018; SOLIGNAT et al., 
2009). O genoma do CHIKV contém duas ORFs (Open Reading Frame), ou quadro 
de leitura aberto. A primeira ORF codifica uma proteína precursora que é processada 
para dar origem as quatro proteínas não estruturais: nsP1, nsP2, nsP3 e nsP4, que 
juntas formam o complexo de replicação viral. A segunda ORF codifica uma proteína 
precursora que depois de processada dá origem as cinco proteínas estruturais: C ( 
capsídeo), as três glicoproteínas do envelope (E1, E2, E3) e a proteína 6K (Figura 3) 
(KHAN et al., 2002; MOIZÉIS et al., 2018). 
19 
 
Figura 3 – Representação do genoma do vírus Chikungunya. 
 
Fonte: Adaptado de SINGH et al., 2018. 
Legenda: O genoma possui duas ORFs (Open Reading Frame), na qual a primeira, que 
ocupa 2/3 da extremidade 5’, codifica as proteínas envolvidas na replicação viral, e a 
segunda codifica as proteínas estruturais como por exemplo, membrana, capsídeo e 
envelope. 
 
As proteínas estruturais, como mencionado anteriormente, são responsáveis 
por manter a integridade do vírus, protegendo o material genético para que possa se 
propagar de um hospedeiro a outro e atuando na inoculação do vírus na célula 
hospedeira (ROUSSEL et al., 2006). Para a entrada do vírus na célula, a glicoproteína 
E2 atua como agente ligante a células do hospedeiro. Foi analisado que essa proteína 
tem afinidade com a proteína de membrana Prohibitin 1 (PHB1), expressa por diversas 
células, e atua como receptora do vírus (WINTACHAI et al., 2012). Além dela, a Mxr8a, 
célula de adesão molecular, imunoglobulina de célula T e a Mucin Domain-1 (TIM-1) 
20 
 
foram descritas como auxiliadoras da infecção viral (VAN DUIJL-RICHTER et al., 
2015). 
Próximo à parte codante das proteínas estruturais localiza-se uma região 
chamada de 3’NTR, ou região não codante, composta por 526 nucleotídeos, e 
regulam a síntese do RNA viral (DUDHA et al., 2015; PFEFFER; KINNEY; KAADEN, 
1998; RANGEL et al., 2022). 
Para a replicação do vírus dentro do hospedeiro são necessárias as proteínas 
não estruturais, derivadas do RNA genômico. A primeira, nsP1, atua para a 
associação do vírus a membrana da célula hospedeira por palmitoilação (AHOLA et 
al., 2000), além de ser responsável por adicionar o cap na extremidade 5’ da 
sequência (VASILJEVA et al., 2003). A nsP2 atua como helicase, trifosfatase e 
protease. A nsP3 promove a síntese viral, como também na promoção de mutações. 
A nsP4 não atua na replicação viral, mas no complexo de replicase viral (RUPP et al., 
2015) 
O vírus tem preferência de replicação em fibroblasto e macrófagos, em níveis 
teciduais, são amplificados no lugar da infecção, na pele e nos monócitos, até 
atingirem órgãos linfóides e não linfóides, como articulações sinoviais e o musculo 
esquelético. Isso explica porque essa doença provocar sintomas como a poliartralgia 
e dores pelo corpo(MATUSALI et al., 2019). 
 
1.4 Manifestações Clinicas 
 
O principal sintoma atribuído a Chikungunya é a febre, visto que a própria 
doença recebeu o nome de febre Chikungunya. A temperatura corporal nesses casos 
é bastante elevada, que pode exceder 39°C, junto de erupções cutâneas e dores 
severas nas articulações (INAMADAR et al., 2008; ROBINSON, 1956). Esse padrão 
sintomático data desde as primeiras documentações da doença, no entanto, mais 
características foram adicionadas com a observação de novos casos, que inclui dor 
de cabeça, fadiga, náusea e vômitos (POWERS, 2010). 
Geralmente os sintomas demoram de 3 a 7 dias para aparecer, o que pode 
durar até 12 dias, e após a contaminação, o vírus pode ficar no organismo por volta 
de 10 dias. A febre CHIKV é dividida em fase aguda, subaguda e crônica, a depender 
da duração das dores causadas pelas inflamações (SIMON et al., 2007). Para 
21 
 
diagnosticar a febre Chikungunya são realizadas algumas etapas que permitem 
conduzir o paciente para um tratamento, como também auxilia na diferenciação da 
doença (Figura 4). 
A fase aguda da doença dura de 10 a 21 dias e se caracteriza por febre de 
surgimento abrupto, dores poliarticulares, que começam de dois a cinco dias após o 
início dos sintomas (MINISTÉRIO DA SAÚDE, 2015). Nessa fase, as dores podem 
ser espalhadas pelo corpo, ou localizadas, mais comumente, nas mãos, pulsos, pés 
e tornozelos (DE SOUZA et al., 2022). Aproximadamente metade dos casos 
apresentam problemas cutâneos, sejam eles edemas e exantemas, com prurido e 
rash, e em menor frequência, sintomas gastrointestinais incluindo diarreias e vômitos 
(THIBERVILLE et al., 2013). 
Após o fim da fase aguda, se os sintomas persistirem depois de 21 dias até 
três meses, o paciente é considerado em fase subaguda, em que geralmente a febre 
desaparece, mas as dores articulares e edemas continuam, e podem agravar, além 
do aparecimento de tenossinovite nos pulsos(SÁNCHEZ; CAÑÓN; LOMBO, 2019). 
Um estudo feito com pessoas infectadas na fase aguda as quais apresentavam 
artralgias mostrou que a quimiocina CXL8 estava em maior nível nas amostras 
sanguíneas, quando desenvolviam dores crônicas. A partir desses dados foi levantada 
a hipótese que essa quimiocina, se presente em níveis elevados na fase aguda, seria 
um fator importante para o seguimento da doença para a fase crônica (JACOB-
NASCIMENTO et al., 2021). 
Após três meses, a persistência de sintomas caracteriza a fase crônica, com 
fortes dores articulares que limitam as atividades diárias dos que foram infectados 
peladoença. Divididos em três grupos, os sintomas comuns nessa fase são: artrites 
inflamatórias, condições musculoesqueléticas dolorosas e neuropatias ( 
SECRETARIA DE ESTADO DA SAÚDE DE SÃO PAULO, 2021). As artrites 
inflamatórias se assemelham muito a artrite reumatoide e pode acabar levando a um 
diagnóstico impreciso, como os altos níveis de IL-6, presente em ambas as condições 
(AMARAL; BILSBORROW; SCHOEN, 2020). Porém, por apresentarem 
características semelhantes, o tratamento da artrite reumatoide pode ser um bom 
candidato ao tratamento das inflamações articulares causadas pela Chikungunya 
(JAVELLE et al., 2015). 
Além das três fases apresentadas, a Chikungunya pode manifestar sintomas 
classificados como atípicos, pouco relacionados a essa doença. Síndrome de Guillain-
22 
 
Barré (LEBRUN et al., 2009), depressão(YASEEN et al., 2014) e alopecia (MORO et 
al., 2012) foram alguns dos sintomas avaliados em pacientes pós Chikungunya (VAN 
AALST et al., 2017), além de casos assintomáticos. 
 
1.5 Diagnóstico 
 
O diagnóstico laboratorial da Febre da Chikungunya pode ser feito de 
diferentes formas, a depender do tempo de doença, tendo como alvo o genoma viral, 
o vírus, proteínas virais ou anticorpos específicos para a Chikungunya (POWERS, 
2010). Para os dias iniciais da doença, ou seja, durante a fase da viremia, no início da 
fase aguda, em que os sintomas estão presentes, o genoma viral pode ser detectado 
pela RT-qPCR. Após o período virêmico, a pesquisa de anticorpos da classe IgM é o 
indicado (VU; JUNGKIND; ANGELLE DESIREE LABEAUD, 2017). Os exames 
sorológicos realizados pelo método ELISA conseguem detectar níveis de IgM, o qual 
consegue ser realizado 6 dias após o início dos sintomas, e IgG, o qual detecta o vírus 
a partir de 21 dias de doença (LITZBA et al., 2008; SILVA et al., 2018). 
Em casos agudos, a viremia por volta do 6° dia estará alta o suficiente para 
ser detectada com exames de isolamento viral ou moleculares de quantificação viral, 
como o RT-qPCR (LANCIOTTI et al., 2007). Por serem exames de alta sensibilidade 
e rápida execução e análise, métodos como RT-qPCR tem sido relevantes no 
diagnóstico da Chikungunya (EDWARDS et al., 2007). 
Além desses exames, também é possível analisar a doença através de um 
hemograma, que avaliará aspectos como leucopenia, e o aumento da Proteína C 
Reativa(BRITO; CORDEIRO, 2016). O diagnóstico diferencial também é relevante 
nesse contexto uma vez que a CHIKV apresenta sintomas semelhantes a Dengue, 
Zika, Leptospirose, Malária, Febre Reumática e Artrite Séptica (MINISTÉRIO DA 
SAÚDE, 2015). O diagnóstico pode ser feito por consultas, pela avaliação dos 
sintomas (Figura 6) (PAHO,2017), porém exames laboratoriais fornecem informações 
mais precisas, e assim, um melhor manejo da doença identificada Métodos de análise 
laboratorial são eficientes para doenças co-circulantes, como a dengue, Zika e 
Chikungunya e podem ser realizados com métodos multiplex que conseguem 
diferenciá-las eficientemente (REDDY et al., 2012). 
23 
 
1.5.1 PCR quantitativo em tempo real com transcrição reversa (RT-qPCR) 
 
Para a identificação de um patógeno no paciente, é recomendado que alguns 
testes sejam feitos a fim de que haja um diagnóstico mais preciso. Como exames 
sorológicos são menos precisos e são feitos após um tempo maior que os 
moleculares, exames como o RT-qPCR tornaram-se o padrão ouro nesse âmbito, 
principalmente para a detecção viral (MACKAY; ARDEN; NITSCHE, 2002). 
 O protocolo da PCR foi primeiro descrito em 1983 e, desde então, tem sido 
adaptada para diversos casos (MULLIS et al., 1986). Uma dessas adaptações foi a 
transcriptase reversa (RT), necessária para a detecção viral, uma vez que os vírus 
possuem como material genético o RNA. Para ser realizada a PCR, o RNA precisa 
ser convertido em DNA, em que o processo é feito a partir de um mRNA, transformado 
em cDNA, para então servir de molde para a PCR (BACHMAN, 2013). 
 Na preparação das amostras para a RT-qPCR são adicionados componentes 
essenciais para que o teste seja executado corretamente no termociclador e possa 
fornecer resultados ao fim do experimento. Os principais componentes, os quais 
permitem que a detecção ocorra de forma quantitativa, são corantes e as sondas 
florescentes, que possuem maior especificidade a sequência de nucleotídeos 
desejada (BUSTIN, 2005). 
As sondas acabam tendo vantagem sobre os corantes, ou dyes, como o SYBR 
green, por já terem um primer específico (MACKAY; ARDEN; NITSCHE, 2002). Uma 
dessas sondas, e uma das mais utilizadas é a TaqMan (Applied Biosystems™), 
operada por meio da hidrólise, em que a ligação da sonda é quebrada durante a 
amplificação. Isso ocorre, pois, a sonda é formada por duas extremidades, na 5’ fica 
o fluorofóro, e na 3’ um quencher, que impede a liberação da fluorescência (Figura 4). 
Quando degradado durante a amplificação, um sinal luminoso é enviado e o 
equipamento o reconhece (NAVARRO et al., 2015). Esse passo é importante pois é 
ele que mostrará a amplificação e quantificação viral no final do experimento. 
 
 
 
24 
 
Figura 4 – Ação da sonda TaqMan (Applied Biosystems™) na RT-qPCR. 
 
Fonte: Adaptado de Navarro et al., 2015 
Legenda: A sonda apresentada ao lado esquerdo da imagem contendo o reporter com o 
fluoróforo na extremidade 5’ e o quencher na 3’, responsável por suprimir o reporter. À direita, 
pode-se observar a Taq DNA polimerase liberando o fluoróforo, que emitirá um sinal luminoso, 
que será lido quantitativamente e produzirá um gráfico posteriormente. 
 
Utilizada em diversas áreas, o teste de RT-qPCR fornece a quantificação e 
análise da expressão gênica de forma relativa e absoluta. A quantificação absoluta 
utiliza uma curva padrão de concentração fornecida pelo sistema para analisar os 
valores encontrados, denominado Ct, Cycle Threshold, ou Cq, Ciclo de quantificação, 
ou Quantification Cycle (Figura 5) (HARSHITHA; ARUNRAJ, 2021). O Ct tem como 
definição um ponto em que o sinal fluorescente consegue atravessar um limite 
mínimo, threshold, colocado arbitrariamente no gráfico (SCHMITTGEN; LIVAK, 2008). 
A RT-qPCR permite a análise da quantificação do alvo molecular presente nas 
amostras através da emissão da fluorescência pela sonda. A detecção do sinal se dá 
na fase exponencial, em que a quantidade de amplicons estará em maior quantidade 
pela amplificação do material genético, em que emitirá mais sinais luminosos. Pela 
sensibilidade do teste, quanto menor for o ciclo em que o sinal for emitido, maior será 
a quantificação, registrada pelo valor do Ct. 
 
 
 
 
 
25 
 
Figura 5 – Gráfico demonstrativo da RT-qPCR. 
 
 Fonte: Adaptado de Kubista et al., 2006 
 
Por ser um teste de alta sensibilidade e eficácia, o RT-qPCR é relevante para 
arboviroses como a Chikungunya que precisa de testes mais específicos para que 
seja distinguida de outras arboviroses. Além disso, é relevante comparar o custo de 
kits, visto que, a partir dessa avaliação é possível achar materiais mais 
economicamente viáveis. 
 
1.6 Epidemiologia do vírus Chikungunya e Prevenção 
 
O vírus Chikungunya ocorre em várias localidades do mundo, mas foi primeiro 
descrito na região onde hoje se localiza a Tanzânia, perto da costa da regiões de 
Mawia, Makonde e Rondo(LUMSDEN, 1955). Para tanto, o nome Chikungunya deriva 
do Makonde em que significa aquele que se curva, devido às fortes dores articulares 
provocadas pela doença (VU; JUNGKIND; ANGELLE DESIREE LABEAUD, 2017). A 
primeira documentação desse vírus foi em 1952, e nesse período causou surtos na 
26 
 
Índia e no sudeste Asiático, o qual gerou a primeira linhagem viral conhecida do 
CHIKV (POWERS et al., 2000). Casos isolados ocorreram posteriormente em regiões 
da África por volta de 30 anos, porém novos casos foram notificados em 2004, na 
região do oceano Indico até a China (KARIUKI NJENGA et al., 2008).Concentrado no Velho Mundo até os anos 2000, o CHIKV parecia não 
apresentar riscos para a região das Américas, uma vez que depois de vários surtos, 
o vírus não tinha ainda conseguido chegar no Novo Mundo. No entanto, em 2013 
foram notificados casos de Chikungunya no Caribe e na América Latina, gerando 
preocupações para a disseminação do vírus em outras regiões(LEPARC-GOFFART 
et al., 2014). Os primeiros casos detectados no Brasil ocorreram em 2014 em aldeias 
indígenas no Amapá, com casos importados da linhagem Asiática ,e em Feira de 
Santana, na Bahia, do genótipo Oeste-Sul-Centro Africano, trazido por um paciente 
vindo de Angola, África (AZEVEDO; OLIVEIRA; VASCONCELOS, 2015; NUNES et 
al., 2015). 
Desde então, o território brasileiro tem sofrido com constantes surtos da 
doença, sendo o principal foco a região Nordeste. No ano de 2022, essa parte do país 
apresentou 162.407 casos, em que o estado do Rio Grande do Norte teve 19.722 
casos notificados, de acordo com a SESAP-RN (Secretaria de Saúde do Estado). Até 
a 24° semana de 2023 (20/06/2023) foram notificados 7.643 casos, com a confirmação 
de 1.231. 
As arboviroses não possuem ainda o método de controle e prevenção através 
das vacinas, com exceção da Dengue(HOU; YE; CHEN, 2022). Para a Chikungunya, 
diversas vacinas estão sendo pesquisadas, sendo elas de vírus inativado, adenovírus 
recombinante, DNA-based, VLP e a de vírus atenuado, contudo todas ainda se 
encontram em fase de teste(DE LIMA CAVALCANTI et al., 2022). 
 Devido a isso são necessárias outras maneiras de controlar o surgimento de 
novas epidemias, como foi elaborado em um material da Organização Mundial de 
Saúde (OMS). Esse material conta com direcionamentos para um planejamento de 
contingencia para as arboviroses através de um Sistema de Aviso Prévio, Alerta e 
Resposta - EWAR (WHO, 2023) , o qual utiliza dados de notificações enviados por 
funcionários da saúde, avaliados quanto ao risco e, então ações de saúde pública são 
acionadas. Além disso, o controle mais comum é o dos vetores, em que campanhas 
27 
 
são feitas para a sociedade com o objetivo de extinguir os focos de propagação dos 
mosquitos(MADEWELL, 2020). 
Nesse contexto, este trabalho visa a implantação e avaliação de diferentes 
protocolos de extração de RNA viral para o fortalecimento da vigilância epidemiológica 
de arboviroses de importância médica. 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
28 
 
Figura 6 – Manejo para diagnóstico de paciente suspeito de Chikungunya. 
 
Fonte: Ministério da Saúde. 
 
29 
 
2 OBJETIVOS 
 
1.1 Objetivo Geral 
 
Implantar e avaliar preliminarmente dois protocolos de extração para a 
detecção do genoma do vírus Chikungunya. 
 
2.1 Objetivos específicos 
 
• Avaliar preliminarmente a eficiência de dois protocolos de extração de 
RNA viral; 
• Avaliar o custo benefício de diferentes protocolos de extração para a 
detecção do RNA do vírus Chikungunya; 
• Quantificar amostras de sangue suspeitas de infecção por vírus 
Chikungunya. 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
30 
 
3 MATERIAIS E MÉTODOS 
 
3.1 Local de estudo 
 
Esse projeto foi realizado no Estado do Rio Grande do Norte, na Universidade 
Federal do Rio Grande do Norte no município de Natal, pelo Laboratório de Doenças 
Infecciosas e do Câncer. 
 
3.2 Amostras biológicas analisadas 
 
O presente estudo utilizou dez amostras de pacientes com suspeita de 
infecção por arbovírus. Para a análise desse material biológico foi utilizado soro. Duas 
amostras previamente identificadas como negativas foram utilizadas como controle. 
Adicionalmente, duas amostras positivas para Dengue Vírus Tipo 2 (DENV-2) também 
foram utilizadas como controle. 
As amostras utilizadas no experimento foram fornecidas por diferentes 
unidades de saúde do estado do Rio Grande do Norte, pelo Laboratório Central Dr. 
Almino Fernandes (LACEN-RN) e Secretaria de Saúde de Natal. O material foi 
enviado em alíquotas para o Laboratório de Doenças Infecciosas e do Câncer (LADIC-
UFRN), extraído e purificado. Até a realização do estudo, as alíquotas foram 
armazenadas em freezer -20ºC. 
 
3.3 Diagnóstico molecular do vírus Chikungunya 
 
3.3.1 Extração e Purificação do RNA viral 
 
Um total de 14 amostras foram extraídas com a utilização de dois kits de 
extração, BioGene (QUIBASA, Inc., Minas Gerais, Brasil), e QIAamp Viral RNA Mini 
Kit (250) (QIAGEN, Inc., Valencia, EUA), de acordo com as instruções dos fabricantes. 
31 
 
Após essas etapas, foi realizada a Transcriptase Reversa seguida da Reação de 
Cadeia de Polimerase em tempo real (RT-qPCR). 
 Os kits utilizados seguem um padrão de extração baseado em quatro 
etapas: Lise celular, ligação, lavagem e eluição do RNA. 
 O processo inicia com a lise celular, em que a célula é rompida para que 
o material genético seja liberado para a próxima etapa, a ligação. Como a purificação 
se dá por uma membrana de sílica, é nesse momento em que o ácido nucleico se liga 
a ela. Em seguida, para que não haja contaminação na amostra, são feitas lavagens 
para eliminar possíveis resíduos, e então o RNA segue para a eluição. Nessa etapa, 
o RNA é liberado da membrana em que estava ligado em que estará concentrado e 
purificado (“BIOGENE EXTRAÇÃO DE DNA RNA VIRAL"). 
 
3.3.1.1 BioGene Extração de DNA/RNA Viral 
 
Para iniciar o procedimento, foi necessária a preparação de soluções de 
lavagem e do RNA Carrier, reagentes que serão posteriormente utilizados. Vale 
ressaltar que para a execução desse kit é necessário um banho maria ou um termo 
bloco, além de um equipamento para aquecer o reagente utilizado para ressuspensão 
do RNA Carrier. 
A primeira etapa, da lise das amostras, consiste na pipetagem de 200 µL de 
amostra e a adição de 5µL de Proteinase K, 200µL de tampão de lise e 5,6µL do RNA 
Carrier, todos fornecidos pelo kit. Após homogeneizado, foi adicionado 200µL de 
Etanol (96-100%) na solução para a posterior transferência dela para a coluna de 
sílica. Para a ligação, é colocado o volume total da solução, que contabiliza 610µL, na 
coluna, para então ser centrifugado e extrair o RNA. O conteúdo líquido restante no 
tubo é, então, descartado. 
 Depois que a ligação do RNA é feita nas colunas de sílica, são feitas 2 
lavagens, a primeira com Hidrocloreto de guanidina e TRIS-HCL, e a segunda com 
TRIS-HCL. Após a lavagem, segue-se para a eluição, em que foi adicionada 60µL de 
água livre de RNAse na coluna, sendo esse o volume final do RNA já eluído e 
purificado no tubo coletor. O material foi armazenado à -20°, até ser utilizado. 
32 
 
3.3.1.2 QIAamp Viral RNA Mini Kit (250) 
 
 Para a purificação, o material foi extraído pelo QIAamp Viral RNA Minikit 
(QIAGEN, Inc., Valencia, EUA), de acordo com as instruções do fabricante. Para a 
realização da extração, é necessária a obtenção prévia de uma micro centrífuga e 
tubos de 1,5mL que encaixem nas micro centrífugas, uma vez que não são fornecidos 
com o kit. Após preparados, os reagentes, tampão e Carrier, com o volume de 560µL 
no total, foram colocados no tubo de 1,5mL e, posteriormente, receberam 140µL de 
plasma sanguíneo, resultando no volume de 700µL. Essa mistura quando centrifugada 
permitirá que ocorra a lise celular. Para a ligação à coluna de sílica foram colocados 
560µL de etanol, resultando em 1,26mL de amostra, que foi pipetado para uma coluna 
em um tubo de 2mL fornecida pelo fabricante. 
Após a lise e a ligação, foi adicionado 500μl do tampão AW1, para que fosse 
centrifugado e filtrado, mais 500µL do AW2, filtrado, e a coluna é, então, colocada em 
um tubo de 1,5mL. 
 O material foi eluido com a adição de 60µL do tampão AVE, o qual será 
o volume final do material para a realização do RT-qPCR. O armazenamento foi feito 
à -20° até o momento do uso. 
 
3.3.2 RT-qPCR (Transcriptase Reversa seguida da Reação de Cadeia de Polimerase 
em temporeal) 
 
 O RT-qPCR foi utilizado para a detecção e quantificação do vírus CHIKV 
no experimento. A metodologia utilizada nesse processo foi descrita previamente por 
Lanciotti et. al. (2007). Para esse experimento, foi usada uma sonda fluorescente 
VCHIK 6919P (Applied Biosystems™), e posteriormente foram adicionados dois 
primers iniciadores Primer VCHIK 6856F, direto, e Primer VCHIK 6981R, reverso 
(Invitrogen) (Tabela 1). Para cada sonda e primer uma sequência genômica especifica 
é previamente designada. 
 
 
33 
 
Tabela 1 – Oligonucleotídeos utilizados na reação para a RT-qPCR. 
 
Oligonucleotídeo 
iniciador 
 
Posição no 
Genoma 
Sentido na 
Sequência 
 (5’→3’) 
 
VCHIK 6919P 
 
6919–6941 
 
AGGTACGCGCTTCAAGTTCGGCG 
 
CHIKV 6856F 
 
6856–6879 
 
TCACTCCCTGTTGGACTTGATAGA 
CHIKV 6981R 6981–6956 
TTGACGAACAGAGTTAGGAACATACC 
Fonte: Lanciotti et. al. (2007) 
 
Na próxima etapa, foi adicionado o MasterMix TaqMan™ Fast Virus 1-Step 
Master Mix (Applied Biosystems™), o qual contém os componentes necessários para 
a amplificação do material para que, então, seja recombinado. As placas utilizadas 
nesse processo são então completas com água livre de nuclease, ddH2O, e o volume 
indicado de RNA (Tabela 2). 
 
Tabela 2 – Lista de reagente para a reação de RT-qPCR. 
Reagentes µL/tubo 
VCHIK 6919P 0,2 
CHIKV 6856 1 
CHIKV 6981 1 
TaqMan™ Fast Virus 1-Step Master 
Mix 
2,5 
ddH2O 10,3 
RNA 5 
Fonte: Adaptado de Lanciotti et. al. (2007) 
 
34 
 
O volume final obtido de todos os reagentes mais a adição do RNA resulta em 
20µL, o qual é comportado em placas de 96 poços, nos quais 14 foram usados para 
cada kit. Após serem seladas, as placas seguiram para a análise do material no 
equipamento 7500 fast (Thermo Fisher Scientific Inc.). Para a realização do processo 
foram usados parâmetros de termociclagem indicados pelo fabricante (Tabela 3). 
 
Tabela 3 – Parâmetros de termociclagem. 
Etapas Temperatura Tempo Ciclos 
RT 95° 00:20 1 
Ativação da 
Enzima 
(Amplitaq) 
 
 
95° 
 
 
00:03 
 
 
40 
Desnaturação 
Anelamento / 
Extensão 
60° 00:30 40 
Tempo total - 00:53 - 
Fonte: Adaptado de Lanciotti et. al. (2007) 
 
3.4 Custo benefício dos kits. 
 
A relação de custo beneficio dos kits de extração foi feita a partir da 
comparação dos preços comerciais. Para a análise dos preços foi obtido o número de 
catálogo dos kits, e então, procurado nos sites das empresas fabricantes. 
 
3.5 Aspectos éticos. 
 
Os processos contidos nesse estudo foram aprovados pelo Comitê de Ética 
em Pesquisa da Universidade Federal do Rio Grande do Norte – CAAE: 
51057015.5.0000.5537. 
35 
 
4 Resultados e discussão 
 
4.1 PCR em tempo real (RT-qPCR) 
 
Um total de dez casos suspeitos de Chikungunya foram analisados através do 
método de RT-qPCR, utilizando dois diferentes kits de extração. O kit QIAGEN 
permitiu a detecção de 90% (09/10) dos casos de Chikungunya. Já o kit BioGene 
conseguiu amplificar 100% dos casos (10/10) (Tabela 4). 
 
Tabela 4 – Resultado RT-qPCR. 
Kits de extração QIAamp Viral RNA 
Minikit 
BioGene Extração de 
DNA/RNA Viral 
Amostras positivas 
identificadas 
9 
 
10 
Fonte: Elaborado pelo autor (2023) 
 
 A RT-qPCR, por fornecer um resultado rápido e mais refinado que outros 
métodos, como a PCR convencional (ANDREW et al., 2023; EDWARDS et al., 2017; 
ESPOSITO; FONSECA, 2017), tem sido amplamente usada para fins de diagnóstico 
e experimentos laboratoriais, além da alta eficácia para a amplificação e quantificação 
de material genético (HARSHITHA; ARUNRAJ, 2021). 
Para avaliar a eficiência dos kits utilizados, foram utilizados os valores de Cycle 
threshold (Ct). O Ct, uma vez determinado, permite a avaliação da amplificação do alvo 
amplificado (THIRION et al., 2019). 
Os valores do Ct podem ser determinados à partir dos resultados obtidos em um 
experimento, no entanto, estudos prévios com o CHIKV mostraram que amostras 
positivas tinham valores máximos limitantes a 38 (DE SOUZA et al., 2022; DOS 
SANTOS SOUZA MARINHO et al., 2022; MARTINS et al., 2022). Valores acima disso 
foram considerados negativos, não amplificados ou faziam parte do grupo controle. 
Os valores encontrados no presente estudo foram condizentes com os valores 
36 
 
descritos em outros estudos (Figura 7). Isso é relevante pois mostra uma equivalência 
entre a pesquisa elaborada nesse trabalho e as que já haviam sido feitas previamente. 
Os resultados obtidos pelo método da PCR quantitativa permitiram que os kits 
de extração pudessem ser comparados à nível de qualidade do RNA purificado, e 
também em relação à maior sensibilidade de detecção das sondas e corantes, mesmo 
com cargas virais mais baixas. Isso pode ser observado no BioGene, o qual 
apresentou números mais baixos para o Ct, demonstrando uma maior eficácia para 
esse kit. 
 
Gráfico 1 – RT-qPCR para análise de amostras de pacientes infectados pelo 
vírus Chikungunya (CHIKV). 
 
Fonte: Elaborado pelo autor (2023) 
Legenda: O gráfico mostra que o kit QIAGEN teve como menor resultado 23,48, e o 
maior 36,8; enquanto o kit BioGene apresentou um valor ainda mais baixo, de 20,53, e 
o mais elevado de 35,98, o que demonstra uma maior sensibilidade desse protocolo 
para a quantificação viral. 
 
 
37 
 
4.2 Relação custo benefício 
 
O custo benefício dos kits de extração foi avaliado a partir do valor real utilizado 
por amostra extraída, o qual indicou o método mais vantajoso economicamente 
(Tabela 5). 
 
Tabela 5 – Avaliação de custo kit/amostra 
Kit de Extração Valor do Kit para 250 
amostras 
Custo por amostra 
BioGene Extração de 
DNA/RNA Viral 
R$ 6.360,00 R$ 25,44 
QIAamp Viral RNA Minikit R$9.359,00 R$ 37,43 
Fonte: Elaborado pelo autor (2023) 
 
Por ser uma empresa nacional, a fabricante do BioGene oferece algumas 
vantagens para a obtenção do material, um deles é a praticidade, visto que, para a 
obtenção do QIAamp Viral RNA Minikit é necessário importá-lo, o que gera um custo 
extra no fim das contas. 
A fim de mensurar os valores dos kits, o kit da Qiagen apresentou um valor 
aproximadamente 43% maior que o do kit da BioGene, além de não ter atingido 
valores tão significativos pelo Cycle Threshold, o clico de quantificação. 
Dessa forma, por apresentar níveis maiores de sensibilidade nos testes 
quantitativos, e também por apresentar o valor mais rentável para a extração, o kit 
com melhor custo benefício é o BioGene, o qual custou R$25,44. 
Como descrito anteriormente, o CHIKV é de alta importância para a saúde 
pública por provocar sequelas derivadas de processos inflamatórios, ou até a morte 
(AMARAL; BILSBORROW; SCHOEN, 2020), ou a possibilidade de uma nova 
epidemia (CUNHA et al., 2017) . Por essas questões, esses resultados são relevantes 
e podem fornecer informações para que mais laboratórios, principalmente os que 
38 
 
lidam com uma alta carga de testes frequentemente, tenham acesso a métodos mais 
precisos e eficazes de diagnóstico, principalmente a um custo menor. É interessante 
ressaltar que existem outros kits no mercado que podem ser utilizados em 
comparações futuras. Além disso, vale destacar que o kit de extração também é útil 
em outros espécimes clínicos, que nesse trabalho não foram testados, e também 
podem ser usados para outros testes de biologia molecular, como pesquisa de 
Dengue, Zika e outros vírus de RNA. 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
39 
 
5 Conclusão 
 
Ambos os kits possibilitaram a extração e purificação do RNA viral a partir de 
amostras de soro de pacientes com suspeita de infecção por vírus Chikungunya. 
Contudo, o Kit BioGene permitiu obter melhores níveis de detecção dos alvos 
esperados, além do melhor custo-benefício. Finalmente, os resultados preliminares 
deste estudo mostraram que o Kit da BioGene apresentou mais eficiência para a 
extração e purificação do RNAviral, permitindo uma melhor amplificação da sequência 
alvo e com menor custo. 
 
40 
 
REFERÊNCIAS 
AHOLA, T. et al. Effects of Palmitoylation of Replicase Protein nsP1 on Alphavirus 
Infection. Journal of Virology, v. 74, n. 15, p. 6725–6733, ago. 2000. 
AMARAL, J. K.; BILSBORROW, J. B.; SCHOEN, R. T. Chronic chikungunya arthritis 
and rheumatoid arthritis: what they have in common. The American journal of 
medicine, v. 133, n. 3, p. e91–e97, mar. 2020. 
ANDREW, A. et al. Analytical and Clinical Evaluation of a TaqMan Real-Time PCR 
Assay for the Detection of Chikungunya Virus. Microbiology Spectrum, v. 0, n. 0, p. 
e00088-23, 5 jun. 2023. 
AZEVEDO, R. DO S. DA S.; OLIVEIRA, C. S.; VASCONCELOS, P. F. DA C. 
Chikungunya risk for Brazil. Revista de Saúde Pública, v. 49, p. 58, 29 set. 2015. 
BACHMAN, J. Reverse-transcription PCR (RT-PCR). Methods in Enzymology, v. 
530, p. 67–74, 2013. 
BIO GENE EXTRAÇÃO DE DNA RNA VIRAL_ABR_2020.pdf. , [s.d.]. Disponível em: 
<https://quibasa.bioclin.com.br/anexos/BIO%20GENE%20EXTRA%C3%87%C3%83
O%20DE%20DNA%20RNA%20VIRAL_ABR_2020.pdf>. Acesso em: 14 jun. 2023 
BRITO, C. A. A. DE; CORDEIRO, M. T. One year after the Zika virus outbreak in Brazil: 
from hypotheses to evidence. Revista da Sociedade Brasileira de Medicina 
Tropical, v. 49, p. 537–543, out. 2016. 
BUSTIN, S. A. Real-time, fluorescence-based quantitative PCR: a snapshot of current 
procedures and preferences. Expert Review of Molecular Diagnostics, v. 5, n. 4, p. 
493–498, jul. 2005. 
CHO, B. et al. Expression and Evaluation of Chikungunya Virus E1 and E2 Envelope 
Proteins for Serodiagnosis of Chikungunya Virus Infection. Yonsei Medical Journal, 
v. 49, n. 5, p. 828–835, 31 out. 2008. 
CUNHA, R. V. et al. Seroprevalence of Chikungunya Virus in a Rural Community in 
Brazil. PLOS Neglected Tropical Diseases, v. 11, n. 1, p. e0005319, 20 jan. 2017. 
DE LIMA CAVALCANTI, T. Y. V. et al. A Review on Chikungunya Virus Epidemiology, 
Pathogenesis and Current Vaccine Development. Viruses, v. 14, n. 5, p. 969, 5 maio 
2022. 
DE SOUZA, T. M. A. et al. Was It Chikungunya? Laboratorial and Clinical 
Investigations of Cases Occurred during a Triple Arboviruses’ Outbreak in Rio de 
Janeiro, Brazil. Pathogens, v. 11, n. 2, p. 245, 14 fev. 2022. 
DOS SANTOS SOUZA MARINHO, R. et al. Re-emergence of mayaro virus and 
coinfection with chikungunya during an outbreak in the state of Tocantins/Brazil. BMC 
Research Notes, v. 15, n. 1, p. 271, 3 ago. 2022. 
DUDHA, N. et al. Host-pathogen interactome analysis of Chikungunya virus envelope 
proteins E1 and E2. Virus Genes, v. 50, n. 2, p. 200–209, abr. 2015. 
41 
 
EDWARDS, C. J. et al. Molecular diagnosis and analysis of Chikungunya virus. 
Journal of Clinical Virology, v. 39, n. 4, p. 271–275, 1 ago. 2007. 
EDWARDS, T. et al. Analytical and clinical performance of a Chikungunya qRT-PCR 
for Central and South America. Diagnostic Microbiology and Infectious Disease, v. 
89, n. 1, p. 35–39, set. 2017. 
ESPOSITO, D. L. A.; FONSECA, B. A. L. DA. Sensitivity and detection of chikungunya 
viral genetic material using several PCR-based approaches. Revista da Sociedade 
Brasileira de Medicina Tropical, v. 50, p. 465–469, ago. 2017. 
HARSHITHA, R.; ARUNRAJ, D. R. Real-time quantitative PCR: A tool for absolute and 
relative quantification. Biochemistry and Molecular Biology Education: A 
Bimonthly Publication of the International Union of Biochemistry and Molecular 
Biology, v. 49, n. 5, p. 800–812, set. 2021. 
HIGGSSTEPHEN; VANLANDINGHAMDANA. Chikungunya Virus and Its Mosquito 
Vectors. Vector-Borne and Zoonotic Diseases, 21 abr. 2015. 
HOU, J.; YE, W.; CHEN, J. Current Development and Challenges of Tetravalent Live-
Attenuated Dengue Vaccines. Frontiers in Immunology, v. 13, p. 840104, 24 fev. 
2022. 
INAMADAR, A. C. et al. Cutaneous manifestations of chikungunya fever: observations 
made during a recent outbreak in south India. International Journal of Dermatology, 
v. 47, n. 2, p. 154–159, 2008. 
JACOB-NASCIMENTO, L. C. et al. Acute-Phase Levels of CXCL8 as Risk Factor for 
Chronic Arthralgia Following Chikungunya Virus Infection. Frontiers in Immunology, 
v. 12, 2021. 
JAVELLE, E. et al. Specific Management of Post-Chikungunya Rheumatic Disorders: 
A Retrospective Study of 159 Cases in Reunion Island from 2006-2012. PLOS 
Neglected Tropical Diseases, v. 9, n. 3, p. e0003603, 11 mar. 2015. 
JOSE, J.; SNYDER, J. E.; KUHN, R. J. A structural and functional perspective of 
alphavirus replication and assembly. Future Microbiology, v. 4, n. 7, p. 837–856, set. 
2009. 
KARIUKI NJENGA, M. et al. Tracking epidemic Chikungunya virus into the Indian 
Ocean from East Africa. Journal of General Virology, v. 89, n. 11, p. 2754–2760, 
2008. 
KHAN, A. H. et al. Complete nucleotide sequence of chikungunya virus and evidence 
for an internal polyadenylation site. Journal of General Virology, v. 83, n. 12, p. 
3075–3084, 1 dez. 2002. 
LANCIOTTI, R. S. et al. Chikungunya Virus in US Travelers Returning from India, 2006. 
Emerging Infectious Diseases, v. 13, n. 5, p. 764–767, maio 2007. 
LEBRUN, G. et al. Guillain-Barré Syndrome after Chikungunya Infection - Volume 15, 
Number 3—March 2009 - Emerging Infectious Diseases journal - CDC. [s.d.]. 
42 
 
LEPARC-GOFFART, I. et al. Chikungunya in the Americas. The Lancet, v. 383, n. 
9916, p. 514, 8 fev. 2014. 
LITZBA, N. et al. Evaluation of the first commercial chikungunya virus indirect 
immunofluorescence test. Journal of Virological Methods, v. 149, n. 1, p. 175–179, 
1 abr. 2008. 
LUMSDEN, W. H. R. An epidemic of virus disease in Southern Province, Tanganyika 
territory, in 1952–1953 II. General description and epidemiology. Transactions of the 
Royal Society of Tropical Medicine and Hygiene, v. 49, n. 1, p. 33–57, 1 jan. 1955. 
MACKAY, I. M.; ARDEN, K. E.; NITSCHE, A. Real-time PCR in virology. Nucleic 
Acids Research, v. 30, n. 6, p. 1292–1305, 15 mar. 2002. 
MADEWELL, Z. J. Arboviruses and Their Vectors. Southern Medical Journal, v. 113, 
n. 10, p. 520–523, out. 2020. 
MARTINS, E. B. et al. Detection of Chikungunya virus in bodily fluids: The INOVACHIK 
cohort study. PLoS Neglected Tropical Diseases, v. 16, n. 3, p. e0010242, 7 mar. 
2022. 
MATUSALI, G. et al. Tropism of the Chikungunya Virus. Viruses, v. 11, n. 2, p. 175, 
20 fev. 2019. 
MINISTÉRIO DA SAÚDE. Febre de chikungunya: manejo clínico. 2015. 
MOIZÉIS, R. N. C. et al. Chikungunya fever: a threat to global public health. 
Pathogens and Global Health, v. 112, n. 4, p. 182–194, jun. 2018. 
MORO, M. L. et al. Long-term chikungunya infection clinical manifestations after an 
outbreak in Italy: A prognostic cohort study. Journal of Infection, v. 65, n. 2, p. 165–
172, 1 ago. 2012. 
NAVARRO, E. et al. Real-time PCR detection chemistry. Clinica Chimica Acta; 
International Journal of Clinical Chemistry, v. 439, p. 231–250, 15 jan. 2015. 
NUNES, M. R. T. et al. Emergence and potential for spread of Chikungunya virus in 
Brazil. BMC Medicine, v. 13, n. 1, p. 102, 30 abr. 2015. 
Pan American Health Organization. Tool for the Diagnosis and Care of Patients 
with Suspected Arboviral Diseases, 2017. Disponível em: 
<https://iris.paho.org/bitstream/handle/10665.2/33895/9789275119365_eng.pdf?seq
uence=1%26isAllowed=y>. Acesso em: 7 jul. 2023 
PFEFFER, M.; KINNEY, R. M.; KAADEN, O.-R. The Alphavirus 3Ј-Nontranslated 
Region: Size Heterogeneity and Arrangement of Repeated Sequence Elements. [s.d.]. 
POWERS, A. M. et al. Re-emergence of Chikungunya and O’nyong-nyong viruses: 
evidence for distinct geographical lineages and distant evolutionary relationships. The 
Journal of General Virology, v. 81, n. Pt 2, p. 471–479, fev. 2000. 
43 
 
POWERS, A. M. Chikungunya. Clinics in Laboratory Medicine, v. 30, n. 1, p. 209–
219, mar. 2010. 
RANGEL, M. V. et al. Emerging Chikungunya Virus Variants at the E1-E1 
Interglycoprotein Spike Interface Impact Virus Attachment and Inflammation. Journal 
of Virology, v.96, n. 4, p. e0158621, 23 fev. 2022. 
REDDY, V. et al. Utility of IgM ELISA, TaqMan real-time PCR, reverse transcription 
PCR, and RT-LAMP assay for the diagnosis of Chikungunya fever. Journal of Medical 
Virology, v. 84, n. 11, p. 1771–1778, nov. 2012. 
ROBINSON, M. C. An epidemic of a dengue-like fever in the southern province of 
Tanganyika. The Central African Journal of Medicine, v. 2, n. 11, p. 394–396, nov. 
1956. 
ROSS, R. W. The Newala epidemic. III. The virus: isolation, pathogenic properties and 
relationship to the epidemic. The Journal of Hygiene, v. 54, n. 2, p. 177–191, jun. 
1956. 
ROUSSEL, A. et al. Structure and interactions at the viral surface of the envelope 
protein E1 of Semliki Forest virus. Structure (London, England: 1993), v. 14, n. 1, p. 
75–86, jan. 2006. 
RUPP, J. C. et al. Alphavirus RNA synthesis and non-structural protein functions. The 
Journal of General Virology, v. 96, n. 9, p. 2483–2500, set. 2015. 
SÁNCHEZ, J. S.; CAÑÓN, A. M.; LOMBO, J. C. Síntomas subagudos y crónicos de la 
fiebre de chikungunya en un grupo de personas adultas en Ibagué, Colombia. 
Biomédica, v. 39, n. 3, p. 587–594, 1 set. 2019. 
 SECRETARIA DE ESTADO DA SAÚDE DE SÃO PAULO. Protocolo de Manejo 
Clínico de Chikungunya no Estado de São Paulo, 2021. 
SCHMITTGEN, T. D.; LIVAK, K. J. Analyzing real-time PCR data by the comparative 
C(T) method. Nature Protocols, v. 3, n. 6, p. 1101–1108, 2008. 
SILVA, J. V. J. et al. A scoping review of Chikungunya virus infection: epidemiology, 
clinical characteristics, viral co-circulation complications, and control. Acta Tropica, v. 
188, p. 213–224, dez. 2018. 
SIMON, F. et al. Chikungunya infection: an emerging rheumatism among travelers 
returned from Indian Ocean islands. Report of 47 cases. Medicine, v. 86, n. 3, p. 123–
137, maio 2007. 
SINGH, A. et al. Deciphering the dark proteome of Chikungunya virus. Scientific 
Reports, v. 8, n. 1, p. 5822, 11 abr. 2018. 
SOLIGNAT, M. et al. Replication cycle of chikungunya: a re-emerging arbovirus. 
Virology, v. 393, n. 2, p. 183–197, 25 out. 2009. 
STRAUSS, J. H.; STRAUSS, E. G. The alphaviruses: Gene expression, replication, 
and evolution. Microbiological Reviews, v. 58, n. 3, p. 491–562, 1994. 
44 
 
THIBERVILLE, S.-D. et al. Chikungunya fever: Epidemiology, clinical syndrome, 
pathogenesis and therapy. Antiviral Research, v. 99, n. 3, p. 345–370, 1 set. 2013. 
THIRION, L. et al. Development and Evaluation of a Duo Chikungunya Virus Real-
Time RT-PCR Assay Targeting Two Regions within the Genome. Viruses, v. 11, n. 8, 
p. 755, ago. 2019. 
VAN AALST, M. et al. Long-term sequelae of chikungunya virus disease: A systematic 
review. Travel Medicine and Infectious Disease, v. 15, p. 8–22, jan. 2017. 
VAN DUIJL-RICHTER, M. K. S. et al. Early Events in Chikungunya Virus Infection—
From Virus CellBinding to Membrane Fusion. Viruses, v. 7, n. 7, p. 3647–3674, jul. 
2015. 
VASILJEVA, L. et al. Regulation of the sequential processing of Semliki Forest virus 
replicase polyprotein. The Journal of Biological Chemistry, v. 278, n. 43, p. 41636–
41645, 24 out. 2003. 
VOGEL, R. H. et al. Envelope structure of Semliki Forest virus reconstructed from cryo-
electron micrographs. Nature, v. 320, n. 6062, p. 533–535, 10 abr. 1986. 
VU, D. M.; JUNGKIND, D.; ANGELLE DESIREE LABEAUD. Chikungunya Virus. 
Clinics in Laboratory Medicine, v. 37, n. 2, p. 371–382, jun. 2017. 
WEAVER, S. C. Arrival of chikungunya virus in the new world: prospects for spread 
and impact on public health. PLoS neglected tropical diseases, v. 8, n. 6, p. e2921, 
jun. 2014. 
WINTACHAI, P. et al. Identification of prohibitin as a Chikungunya virus receptor 
protein. Journal of Medical Virology, v. 84, n. 11, p. 1757–1770, 2012. 
World Health Organization. Early Warning Alert and Response in Emergencies: an 
operational guide. 2022. 
YASEEN, H. M. et al. Identification of initial severity determinants to predict arthritis 
after chikungunya infection in a cohort of French gendarmes. BMC Musculoskeletal 
Disorders, v. 15, n. 1, p. 249, 24 jul. 2014.

Continue navegando