Logo Passei Direto
Buscar
Material
páginas com resultados encontrados.
páginas com resultados encontrados.

Escolha uma das opções e acesse esse e outros materiais sem bloqueio. 🤩

Cadastre-se ou realize login

Ao continuar, você aceita os Termos de Uso e Política de Privacidade

Escolha uma das opções e acesse esse e outros materiais sem bloqueio. 🤩

Cadastre-se ou realize login

Ao continuar, você aceita os Termos de Uso e Política de Privacidade

Escolha uma das opções e acesse esse e outros materiais sem bloqueio. 🤩

Cadastre-se ou realize login

Ao continuar, você aceita os Termos de Uso e Política de Privacidade

Escolha uma das opções e acesse esse e outros materiais sem bloqueio. 🤩

Cadastre-se ou realize login

Ao continuar, você aceita os Termos de Uso e Política de Privacidade

Prévia do material em texto

Legal Medicine 14 (2012) 47–50
Contents lists available at SciVerse ScienceDirect
Legal Medicine
journal homepage: www.elsevier .com/locate / legalmed
Brief Communication
Determination of ABO genotypes by real-time PCR using allele-specific primers
Tomonori Muro a,b, Junko Fujihara a, Shinji Imamura a,b, Hiroaki Nakamura b, Kaori Kimura-Kataoka a,
Tomoko Toga a, Reiko Iida c, Toshihiro Yasuda d, Haruo Takeshita a,⇑
a Department of Legal Medicine, Faculty of Medicine, Shimane University, Izumo 693-8501, Japan
b Criminal Investigation Laboratory, Shimane Prefectural Police Headquarters, Matsue 690-8510, Japan
c Division of Life Sciences, Faculty of Medical Sciences, University of Fukui, Fukui 910-1193, Japan
d Division of Medical Genetics and Biochemistry, Faculty of Medical Sciences, University of Fukui, Fukui 910-1193, Japan
a r t i c l e i n f o
Article history:
Received 31 October 2010
Received in revised form 4 October 2011
Accepted 18 October 2011
Available online 16 December 2011
Keywords:
ABO genotyping
Allele-specific primer
Real-time PCR
Single nucleotide polymorphism (SNP)
1344-6223/$ - see front matter � 2011 Elsevier Irelan
doi:10.1016/j.legalmed.2011.10.002
⇑ Corresponding author. Tel.: +81 853 20 2156; fax
E-mail address: htakeshi@med.shimane-u.ac.jp (H
a b s t r a c t
ABO grouping of biological specimens is informative for identifying victims and narrowing down sus-
pects. In Japan and elsewhere, ABO grouping as well as DNA profiling plays an essential role in crime
investigations. In the present study, we developed a new method for ABO genotyping using allele-specific
primers and real-time PCR. The method allows for the detection of three single nucleotide polymor-
phisms (SNPs) at nucleotide positions 261, 796, and 803 in the ABO gene and the determination of six
major ABO genotypes. This method required less than 2 h for accurate ABO genotyping using 2.0 ng of
DNA. This method could be applicable for rapid and simple screening of forensic samples.
� 2011 Elsevier Ireland Ltd. All rights reserved.
1. Introduction
In Japan and elsewhere, the ABO blood groups have been used
for personal identification and paternity testing in forensic medi-
cine and criminal investigations for many years, because the ABO
blood group obtained from evidentiary samples is usually one of
the initial pieces of information available that could lead to identi-
fication of a culprit. ABO blood grouping has also been used as ini-
tial information for the identification of missing persons and
victims of crimes and disasters.
Typing strategies exploiting the ABO gene rather than its gene
products are useful for forensic casework samples, such as bones,
decomposed organs, and semen-contaminated vaginal fluid, which
are difficult to type using serological methods. To date, a range of
techniques have been reported for the genotyping of major ABO al-
leles, such as polymerase chain reaction (PCR)-restriction fragment
length polymorphism (PCR-RFLP) analysis [1], mutagenically sepa-
rated PCR (MS-PCR) [2], PCR with sequence-specific primers (PCR-
SSP) [3,4], multiplexed allele-specific PCR [5,6], PCR-amplified
products length polymorphism (PCR-APLP) [7], and single-strand
conformation polymorphism [8]. These methods are, however, dis-
advantageous due to the need for multiple post-amplification
steps, such as electrophoresis and enzyme cleavage, and for this
reason often have a risk of carry-over contamination. Recently,
d Ltd. All rights reserved.
: +81 853 20 2155.
. Takeshita).
improved methods such as GeneScan fragment analysis [9,10],
minisequencing analysis [11], and microarray-based genotyping
[12,13] of ABO have also been reported. Unfortunately, however,
post-PCR manipulations are still needed, and the equipment is
not convenient for use on a routine basis.
In the present study, we developed an ABO genotyping method
taking advantage of the high rapidity of real-time PCR. Using four
allele-specific primers and two common primers, six genotypes
of the four major ABO serotypes were determined. This reliable,
rapid, and simple method serves as a useful supplement to stan-
dard serological typing in forensic testing.
2. Materials and methods
2.1. Samples and DNA extraction
Peripheral blood samples from 54 healthy blood donors whose
phenotypes had been determined by serological methods (forward
and reverse grouping) were collected after obtaining informed con-
sent; the phenotypes of these 54 samples (sample numbers 1–54)
included A (n = 24), B (n = 10), O (n = 15), and AB (n = 5). Forensic
casework samples consisted of blood and nails from decomposed
bodies (sample numbers 55 and 56). The ABO phenotypes of the
two casework samples were examined serologically by the elution
test. Genomic DNA was extracted using a QIAamp� DNA mini kit
(Qiagen, Chatsworth, CA, USA) following the manufacturer’s proto-
col. DNA concentrations of all samples, except the two casework
http://dx.doi.org/10.1016/j.legalmed.2011.10.002
mailto:htakeshi@med.shimane-u.ac.jp
http://dx.doi.org/10.1016/j.legalmed.2011.10.002
http://www.sciencedirect.com/science/journal/13446223
http://www.elsevier.com/locate/legalmed
48 T. Muro et al. / Legal Medicine 14 (2012) 47–50
samples, were measured spectrophotometrically using a DU 640
(Beckman Coulter, Fullerton, CA, USA). The study was approved
by the Human Ethics Committee of Shimane University. All DNA
samples were also genotyped for ABO by the PCR-APLP method [7].
2.2. Real-time PCR
Allele-specific PCR was employed for ABO genotyping. Various
ABO alleles have been reported in the Japanese population [14–
16]. The major alleles are grouped as A, B, and O on the basis of
three single nucleotide polymorphisms (SNPs) at nucleotide poti-
sions (nt) 261, 796, and 803 [14–16]. To identify these three SNPs,
we prepared four reaction systems (reaction systems 1–4). Reac-
tion system 1 detects the A and B alleles, which have a G at nt
261. Reaction system 2 detects the O allele, which has a deletion
at nt 261. Reaction system 3 detects the B allele, which has an A
at nt 796. Reaction system 4 detects the A and O alleles, which
have a G at nt 803. Six primers were designed with reference to
the PCR-APLP method [7], and their sequences are shown in
Table 1. The ABO alleles, oligonucleotide primer positions relative
to the consensus sequence, and sizes of the PCR products are illus-
trated in Fig. 1. The criteria for genotyping are shown in Table 2.
Each PCR reaction system contained 15 ll of Power SYBR�
Green PCR Master Mix (Applied Biosystems, Foster City, CA, USA)
and 0.6 ll of each of the forward primers and reverse primers at
a final concentration of 0.2 lM. After addition of 1 ll of 1 ng/ll
genomic DNA template, the final reaction volume was brought to
30 ll by addition of distilled water. Real-time PCR was run on an
ABI PRISM� 7000 Sequence Detection System (Applied Biosystems)
in 96-well microtiter plates in accordance with the manufacturer’s
protocol. Thermal cycling was started with denaturation at 95 �C
for 10 min, followed by 35 cycles of 94 �C for 30 s, 63 �C for 30 s,
Table 1
Allele-specific primers used for ABO genotyping.
Name Sequences (50 to 30)
6F-AB GGAAGGATGTCCTCGTGGTGA
6F-O GATGTCCTCGTGGTAC
6R CTCGTTGAGGATGTCGATGTTG
7F-B GACGAGGGCGATTTCTACTACA
7F-AO TCTACTACCTGGGGGG
7R TTGGCCTGGTCGACCATCATG
Exon6 Exon7
nt261 nt796 nt803
Reaction system 1(79bp) Reaction system 3 (107 bp)
6F-AB 7F-B
A,B allele G B allele A C
6R 7R
Reaction system 2 (74bp) Reaction system 4 (94bp)
7F AO6F-O 7F-AO
O allele del A,O allele C G
6R 7R
Fig. 1. Schematic diagram of the ABO gene and the priming sites for four allele-
specific forward primers and two reverse primers used in this study. PCR reaction
systems 1 and 2: PCR amplification of the exon 6 fragment including SNP at nt 261.
PCR reaction systems 3 and 4: PCR amplification of the exon 7 fragment including
SNPs at nt 796 and 803.
and 72 �C for 30 s. The amplification was followed by melting curve
analysis, which was started at 60 �Cfor 45 s and then increased to
95 �C at 0.1 �C/s, with the fluorescence signal continuously moni-
tored. A negative PCR control was amplified in parallel. Data were
analyzed using ABI PRISM� 7000 SDS Software (Applied Biosys-
tems,). We defined the reaction as positive when its amplification
curve reached the threshold line (1.0e-001). To test the sensitivity
of PCR amplifications, serial dilutions at concentrations of 40,000,
20,000, 10,000, 5000, 2000, 1500, 1000, 800, 500, 200, 100, 50,
and 10 pg/ll genomic DNA were prepared.
3. Results
The typical PCR amplification plots and melting curves of six
common genotypes obtained from 1 ng genomic DNA are shown
in Fig. S1. The ABO genotype of each sample was determined based
on the interpretative criteria (Table 2). Fig. 2 shows the threshold
cycle (Ct) values of 54 samples in each genotype. The Ct values
of positive reactions were approximately 25–30 when we added
1 ng genomic DNA to the PCR reaction mixture. The Ct values of
negative reactions could not be determined because the amplifica-
tion curve did not reach the threshold line after 35 cycles of ampli-
fication. All samples were also genotyped using the PCR-APLP
method [7]. The two genotyping methods gave the same results.
There were no discrepancies between these results and serological
phenotypes.
The specificity of the four primer pairs in all reaction systems
was confirmed by the melting curve analysis. Values of melting
temperature (Tm) for reaction systems 1–4 were 81.67–82.04 �C,
81.78–82.31 �C, 85.89–86.08 �C, and 85.04–85.62 �C, respectively.
Since the amount of DNA obtained from forensic samples is fre-
quently limited, we tested the detection sensitivity of this method.
The detection limit of each reaction system was 0.5 ng for accurate
ABO genotyping because the amplification curve did not reach the
threshold line with quantities of DNA under 0.5 ng. With quantities
of DNA exceeding 20 ng, undesired amplification (Ct values of
about 33–35) was observed in reaction systems 1 and 2, which
interfered with interpretation of the results. Addition of excessive
amounts of template was undesirable for this PCR reaction. Serial
experiments with decreasing quantities of DNA template showed
that each reaction system worked well within the range 0.5–
10 ng of DNA.
The method developed here was applied to the two samples
from practical cases (Nos. 55 and 56). These samples were ampli-
fied without measuring the DNA concentration. Their DNA concen-
tration were considered to be about 1–2 ng/ll because their Ct
values ranged from 25 to 26, indicating that the PCR reaction mix-
tures had contained the appropriate quantities of template DNA.
Samples 55 and 56 were genotyped as AO and BB, respectively,
as shown in Fig. 2.
4. Discussion
Forensic biologists are required to provide reliable results for
ABO blood typing even from minute, degraded, or very poor-qual-
ity samples. ABO genotyping is increasingly used for these samples
due to its distinct advantages over serological typing in many re-
spects [6,17]. Nevertheless, technical difficulties inherent to cur-
rent approaches have greatly hindered their wide acceptance.
The PCR-RFLP method was the first ABO genotyping method ap-
plied to forensic samples, and is currently that used most com-
monly. However, this method can result in mistyping because of
incomplete digestion with restriction enzymes [18]; in particular,
in contaminated forensic samples, the presence of substances
inhibiting restriction enzymes presumably increases the possibility
Table 2
Genotyping interpretative criteria for the A, B, and O alleles.
Phenotype Genotype Reaction system 1 Reaction system 2 Reaction system 3 Reaction system 4
A AO + + � +
A AA + � � +
B BO + + + +
B BB + � + �
O OO � + � +
AB AB + � + +
+, Positive; �, Negative.
AO AA OOAO AA OO
RS1 RS2 RS3 RS4 RS1 RS2 RS3 RS4 RS1 RS2 RS3 RS4
35
RS1 RS2 RS3 RS4 RS1 RS2 RS3 RS4 RS1 RS2 RS3 RS4
>35
35
30
25
Ct 20
1515
1010
5
0
BO BB ABBO BB AB
RS1 RS2 RS3 RS4 RS1 RS2 RS3 RS4 RS1 RS2 RS3 RS4
35
>35
35
30
25
Ct 20
1515
1010
5
0
Fig. 2. The Ct values of 54 samples and 2 casework samples. RS1–4: reaction systems 1–4, �: samples, j: casework samples. >35 shows negative reactions.
T. Muro et al. / Legal Medicine 14 (2012) 47–50 49
of mistyping. While the PCR-SSCP method is widely used for
screening in SNP analysis, it has a problem with regard to repro-
ducing band patterns, making its forensic application difficult.
The allele-specific PCR method offers technical simplicity and en-
ables the simultaneous detection of multiple SNP sites by multi-
plex PCR. However, the tedious post-PCR manipulations involved
in allele-specific PCR make it a low-throughput method that is
prone to carry-over contamination. The difficulties are significantly
increased with regard to the labor involved in gel electrophoresis,
band visualization, and manual readout. In the present study, a
simple and reliable ABO genotyping system using allele-specific
primers and real-time PCR was developed. Although melting curve
analysis is indispensable for confirming the specificity of each reac-
tion system, its rapidity, together with its simplicity and accuracy,
should promote the acceptance of the real-time PCR detection for-
mat, which eliminates tedious post-PCR manipulations such as gel
electrophoresis. Thus, this system has great potential for automa-
tion in ABO genotyping.
The detection sensitivity of this method was about 2.0 ng of
DNA because each reaction system requires 0.5 ng of DNA for accu-
rate ABO genotyping. In addition, the size of the PCR amplicons
(not longer than 107 bp) was sufficiently small to allow partially
degraded DNA to be used for genotyping. These advantages made
our method very useful for forensic application [19]. Recently, Li
et al. also developed a method for ABO genotyping by real-time
PCR [20]. This method has the advantage of simplicity because
the determination of six major ABO genotypes requires only one
tube. However, this method, which requires four different fluoro-
phor-labeled displacing probes, is not adapted to real-time PCR
systems such as the ABI PRISM� 7000 Sequence Detection System
and the Applied Biosystems 7300 real time PCR System. These sys-
tems can detect four color fluorescence dyes, but one of them is
used as a passive reference dye. Consequently, they can detect only
three different fluorophor-labeled displacing probes. On the other
hand, SYBR Green is one of the most popular dyes, and is adapted
to all real-time PCR systems.
In this study, we detected nucleotide substitutions at three sites
in the ABO gene, thereby allowing identification of the A, B, and O
alleles. Since this method cannot detect cis-AB01 [21], cis-AB02
[22], OB [23], O2 [24], and A2 [25] alleles correctly, these suballeles
or variant alleles cause discrepancies between the determined
genotypes and the serological phenotypes. As for the other subal-
leles, Satoh et al. [26] have suggested that there is no discrepancy
between the genotype and the phenotype on the basis of three
50 T. Muro et al. / Legal Medicine 14 (2012) 47–50
SNPs at nt 261, 796, and 803. Therefore, this method could be used
to screen major ABO genotypes and would be helpful in forensic
testing.
In conclusion, we have established a real-time PCR method
using allele-specific primers for rapid and accurate ABO genotyp-
ing. This method could serve as a useful complement to classic
serological ABO typing and should be helpful in forensic
applications.
Acknowledgements
The authors have declared that they have no conflict of interest.
This work was supported in part by Grants-in-Aid from the Japan
Society for the Promotion of Science (19209025 and 21659175 to
HT, and 22249023 toTY).
Appendix A. Supplementary data
Supplementary data associated with this article can be found, in
the online version, at doi:10.1016/j.legalmed.2011.10.002.
References
[1] Lee JC, Chang JG. ABO genotyping by polymerase chain reaction. J ForesicSci
1992;37:1269–75.
[2] Lee JC, Tsai LC, Chen CH, Chang JG. ABO genotyping by mutagenically separated
polymerase chain reaction. Forensic Sci Int 1996;82:227–32.
[3] Gassner C, Schmarda A, Nussbaumer W, Schonitzer D. ABO glycosyltransferase
genotyping by polymerase chain reaction using sequence-specific primers.
Blood 1996;88:1852–6.
[4] Downing J, Darke C. A modified PCR-SSP method for the identification of ABO
blood group antigens. Eur J Immunogenet 2003;30:295–8.
[5] Pearson SL, Hessner MJ. A(1, 2)BO(1, 2) genotyping by multiplexed allele-
specific PCR. Br J Haematol 1998;100:229–34.
[6] Olsson ML, Irshaid NM, Hosseini-Maaf B, Hellberg A, Moulds MK, Sareneva H,
et al. Genomic analysis of clinical samples with serologic ABO blood grouping
discrepancies: identification of 15 novel A and B subgroup alleles. Blood
2001;98:1585–93.
[7] Watanabe G, Umetsu K, Yuasa I, Suzuki T. Amplified product length
polymorphism (APLP): a novel strategy for genotyping the ABO blood group.
Hum Genet 1997;99:34–7.
[8] Yip SP. Single-tube multiplex PCR-SSCP analysis distinguishable 7 common
ABO alleles and readily identifies new alleles. Blood 2000;95:1487–92.
[9] Yan L, Zhu F, He J. Determining ABO genotypes using GeneScan fragment
analysis. Transfusion 2006;46:1259–60.
[10] Doi Y, Yamamoto Y, Inagaki S, Shigeta Y, Miyaishi S, Ishizu H. A new method
for ABO genotyping using a multiplex single-base primer extension reaction
and its application to forensic casework samples. Leg Med (Tokyo)
2004;6:213–23.
[11] Ferri G, Bini C, Ceccardi S, Pelotti S. ABO genotyping by minisequencing
analysis. Transfusion 2004;44:943–4.
[12] Li LiL, CT LiRY, Sun M, Liu Y, Li Y, Lin Y, et al. ABO genotyping by duplex
amplification and oligonucleotide arrays assay. Fa Yi Xue Za Zhi
2004;20:193–6.
[13] Li L, Li CT, Li RY, Liu Y, Lin Y, Que TZ, et al. SNP genotyping by multiplex
amplification and microarrays assay for forensic application. Forensic Sci Int
2006;162:74–9.
[14] Ogasawara K, Bannai M, Saitou N, Yabe R, Nakata K, Takenaka M, et al.
Extensive polymorphism of ABO blood group gene: three major lineages of the
alleles for the common ABO phenotypes. Hum Genet 1996;97:777–83.
[15] Ogasawara K, Yabe R, Uchikawa M, Saitou N, Bannai M, Nakata K, et al.
Molecular genetic analysis of variant phenotypes the ABO blood group system.
Blood 1996;88:2732–7.
[16] Ogasawara K, Yabe R, Uchikawa M, Bannai M, Nakata K, Takenaka M, et al.
Different alleles cause an imbalance in A2 and A2B phenotypes of the ABO
blood group. Vox Sang 1998;74:242–7.
[17] van der Schoot CE. Molecular diagnostics in immunohaematology. Vox Sang
2004;87:189–92.
[18] Ringel PF, Weiler G, Bein G. Errors in ABO typing of blood stains using PCR. Int J
Legal Med 2000;113:352–5.
[19] Ferri G, Bini C, Ceccardi S, Ingravallo F, Lugaresi F, Pelotti S. Minisequencing-
based genotyping of Duffy and ABO blood groups for forensic purposes. J
Forensic Sci 2006;51:257–360.
[20] Li R, Huian Z, Qinnge L. Multicolor real-time PCR genotyping of ABO system
using displacing probes. J Forensic Sci 2010;55:19–24.
[21] Yamamoto F, McNeill PD, Kominato Y, Yamamoto M, Hakomori S, Ishimoto S,
et al. Molecular genetic analysis of the ABO blood group system:2. Cis-AB
alleles. Vox Sang 1993;64:112–23.
[22] Mifsud NA, Watt JM, Condon JA, Hadadd AP, Sparrow RL. A novel cis-AB variant
allele arising from a nucleotide substitution A796C in the B transferase gene.
Transfusion 2000;40:1276–7.
[23] Olsson ML, Guerreiro JF, Zago MA, Chester MA. Molecular analysis of the O
alleles at the blood group ABO locus in populations of different ethnic origin
reveals novel crossing-over events and point mutations. Biochem Biophys Res
Commun 1997;234:779–82.
[24] Grunnet N, Steffensen R, Bennett EP. Evaluation of histo-blood group ABO
genotyping in a Danish population: frequency of a novel O allele defined as O2.
Vox Sang 1994;67:210–5.
[25] Mitani T, Tsujita H, Kobayashi T, Yokota M, Akane A. A case of DNA analysis of
ABO blood group variant allele A2. Leg Med (Tokyo) 2000;4:197–201.
[26] Satoh K, Itoh Y. Forensic ABO blood grouping by 4 SNPs analyses using ABI
PRISM� 3100 genetic analyzer. Progress in Forensic Genetics 11, Elsevier BV,
Amsterdam 2006; 49–51.
http://dx.doi.org/10.1016/j.legalmed.2011.10.002
	Determination of ABO genotypes by real-time PCR using allele-specific primers
	1 Introduction
	2 Materials and methods
	2.1 Samples and DNA extraction
	2.2 Real-time PCR
	3 Results
	4 Discussion
	Acknowledgements
	Appendix A Supplementary data
	References

Mais conteúdos dessa disciplina