Filogenia molecular

Prévia do material em texto

A Molecular Phylogeny of the Tamarins (genus
Saguinus) Based on Five Nuclear Sequence Data
From Regions Containing Alu Insertions
Divino Bruno da Cunha,1 Eliene Monteiro,1 Marcelo Vallinoto,1 Iracilda Sampaio,1
Stephen F. Ferrari,2 and Horacio Schneider1*
1Genetics and Molecular Biology Laboratory, Coastal Studies Institute, Braganc¸a Campus,
Universidade Federal do Para´, 68.600-000 Braganc¸a-PA, Brazil
2Department of Biology, Universidade Federal de Sergipe, 49.100-000 Sa˜o Cristo´va˜o-SE, Brazil
KEY WORDS Callitrichinae; Cebidae; Amazonian primates; nuclear DNA
ABSTRACT This study presents a molecular phylog-
eny of the Saguinus genus, based on the analysis of the
DNA sequences of five nuclear loci with Alu insertions in
10 species. The concatenated alignment produced a poly-
tomic arrangement with four main groups, although only
two clades—the Amazonian (S. midas, S. niger, and S.
bicolor) and the Colombian (S. leucopus and S. oedipus)
tamarins—were statistically significant. The emergence
of the midas-bicolor clade was estimated at about 5 mil-
lion years ago (mya), and that of the Colombian clade, at
4.6 mya. The phylogenetic relationships among the mus-
tached tamarins (S. mystax, S. imperator, and S. labiatus)
remained unresolved, as did the internal arrangement of
themidas group. The lack of a clear consensus on the phy-
logeny of this group may be related to rapid bursts of evo-
lutionary change within the context of a highly dynamic
environment, which may be difficult to resolve using the
available quantitative approaches. On the other hand, the
discrepancies between mtDNA and nDNA in resolving
phylogenies strongly indicate the role of reticulated evolu-
tion in the evolutionary history of this group. We hope
that the advance of whole genome sequencing technology
and increasing information on nuclear markers and
SNPs, coupled with a better understanding of the geologi-
cal phenomena that took place in western Amazonia over
the past 20 million years, will shed further light on the
phylogenetic history of these New World primates. Am J
Phys Anthropol 000:000–000, 2011. VVC 2011 Wiley-Liss, Inc.
The tamarins of the genus Saguinus Hoffmannsegg,
1807 are the most diverse group of Neotropical primates
(Platyrrhini), with around 35 recognized forms distrib-
uted in at least 15 species (Rylands et al., 2000),
although many aspects of the systematics of the genus
remain controversial. These small-bodied monkeys are
found throughout much of the Amazon basin, the Guya-
nas, and the southern Orinoco basin, and as far north as
Panama (Hershkovitz, 1977; Rylands et al., 2000). Based
on the configuration of facial pelage and pigmentation,
Hershkovitz 1977 divided the genus into hairy-face,
bare-face, and mottled-face sections. The hairy-face
section is the most diverse, with 11 species divided
into three groups—the nigricollis group (S. nigricollis,
S. fuscicollis, S. graellsi, S. melanoleucus, and S. tripar-
titus), the midas group (S. midas and S. niger), and the
mystax group (S. mystax, S. imperator, S. labiatus, and
S. pileatus). Most of the other species are allocated to
the two groups of the bare-face section—the bicolor
group (S. bicolor and S. martinsi) and the oedipus group
(S. oedipus, S. geoffroyi, and S. leucopus). The mottled-
face section includes a single species, S. inustus.
While this arrangement appears to be the most
coherent interpretation of the external morphology and
geographic distribution of the different forms, studies of
dental morphology (Natori and Hanihara, 1992) and
genetics (Cropp et al., 1999; Tagliaro et al., 2005; Araripe
et al., 2008; Matauschek et al., 2011) have provided a dif-
ferent perspective. In particular, phylogenetic analyses
based on the mitochondrial control region and cytochrome
b (Cropp et al., 1999; Matauschek et al., 2011), ND1
(Tagliaro et al., 2005) and rRNA 16S genes (Araripe et al.,
2008), and the nuclear b2-microglobulin gene (Canavez
et al., 1999) have not only confirmed the monophyletic sta-
tus of the genus, but have also indicated the existence of
two main clades, based on body size, rather than external
morphology. The small-bodied clade corresponds to the
nigricollis group (adult body weight typically \450 g),
whereas all the other species are grouped in the large-
bodied clade (body weight[450 g).
Araripe et al. 2008 identified four main lineages of
large-bodied tamarins, three of which coincided with geo-
graphic or morphological groupings. The fourth lineage
Additional Supporting Information may be found in the online
version of this article.
Grant sponsor: Brazilian National Research Council, CNPq;
Grant numbers: 302747/2008-7, 305645/2009-9, 306233/2009-6.
Grant sponsor: CAPES.
*Correspondence to: Horacio Schneider, Laborato´rio de Gene´tica e
Biologia Molecular, Instituto de Estudos Costeiros, Campus de
Braganc¸a, Universidade Federal do Para´, Alameda Leandro Ribeiro
s/n, Bairro Aldeia, 68600-000 Braganc¸a, Para´, Brazil.
E-mail: schneiderhoracio@me.com
Received 19 January 2011; accepted 15 June 2011
DOI 10.1002/ajpa.21587
Published online in Wiley Online Library
(wileyonlinelibrary.com).
VVC 2011 WILEY-LISS, INC.
AMERICAN JOURNAL OF PHYSICAL ANTHROPOLOGY 000:000–000 (2011)
was formed by a single taxon, S. leucopus, in a distinct
clade, well differentiated from all other forms, including
the other members of the oedipus species group. Tagliaro
et al. 2005 obtained similar results using the ND1
gene. Araripe et al. 2008 also recorded relatively high
genetic divergence (around 2% vs. \1% in all other
intraspecific comparisons) between their two specimens
of S. imperator, suggesting the existence of distinct
species. Matauschek et al. 2011 sequenced the complete
mitochondrial cytochrome b gene and the hypervariable
region I of the Control Region focusing primarily on the
small-bodied tamarins (nigricollis species group), which
formed monophyletic clusters, originating around
2.9 million years ago (mya). This analysis refuted the
species status of one form—graellsi—while supporting
the elevation of five S. fuscicollis subspecies to full
species status.
Given the ongoing controversies surrounding the clas-
sification of the different forms, the present study aims
to provide new insights based on the analysis of the nu-
cleotide variation obtained from five independent regions
(chromosomes 2, 6, 8, 19 and X of Callithrix jacchus—
see Table 1). These regions include Alu insertions which
are present in all the representatives of the genera
Saguinus and Callithrix, but not in Cebus, Aotus, and
Saimiri, three other members of the family Cebidae,
sensu Schneider, 2000. Alu elements per se have proven
useful for phylogenetic analyses given that they behave
as a single character and can be detected easily (pres-
ence/absence) using a polymerase chain reaction test,
despite not have been used in the present work with this
purpose. Once in place, Alu insertions are never excised,
following a pattern of directional evolution (Hillis, 1999),
and consequently they are free of homoplasies (Hamdi et
al., 1999; Miyamoto, 1999; Shedlock and Okada, 2000;
Batzer and Deininger, 2002; Roy-Engel et al., 2002).
Thus, once present in the ancestor of a clade, all
descendants should also present the insertion. Patterns
of variation in the sequences of the descendants of a
common ancestor permit the systematic evaluation of
phylogenetic relationships using basic analytical tools.
This is the case of the present work where nucleotide
variation of five loci containing Alu elements and flank-
ing regions was used in order to provide insights into
the phylogenetic relationships of Saguinus genus.
METHODS
In the present study, we analyzed 16 blood or tissue
(muscle) samples from our specimen collection
[sequences for S. labiatus were obtained from Ray et al.,
(2005)], covering 11 tamarintaxa (Table 1), which repre-
sents about 73% of the recognized species (n 5 15)
for the Saguinus genus (Rylands et al., 2000).
Unfortunately, we did not have access to samples from
S. nigricollis, S. graellsi, S. tripartitus, and S. geoffroyi
although some of them are considered closely related to
those represented in the present work, as is the case of
S. tripartitus which was considered for a long time as a
subspecies of S. fuscicollis (Hershkovitz, 1977). For the
extraction of DNA, the samples were digested with
Ribonuclease for 1 h at 378C, followed by Proteinase K
treatment for 2–4 h (or overnight) at 558C. The DNA
was then purified by the standard phenol/chloroform
extraction and precipitation with isopropanol (Sambrook
et al., 1989). The regions including Alu insertions identi-
fied by Ray et al. (2005) were amplified using the pri-
mers of these authors and the polymerase chain reaction
(PCR) technique, with slight variations in the annealing
temperature (Table 2). Initially, a set of primers (n 5 10)
potentially capable of amplifying Saguinus or Saguinus
and Callithrix only, but no other primate genus studied
by Ray et al. (2005) was chosen. The set of five primers
selected were those that produced the best amplification
and sequencing patterns for the majority of our samples.
Amplification by PCR was conducted in a 25 lL vol-
ume containing 4 lL of 1.25 mM dNTP, 2.5 lL of 103
buffer, 1 lL of 25 mM MgCl2, 0.25 lL of each primer
(200 ng/lL), 0.1 lL of genomic DNA (200 ng/lL), 0.1 lL
of 2 U/lL Taq DNA polymerase (Amersham-Pharmacia
Biotech., Piscataway, NJ), and autoclaved double dis-
tilled water to complete 25 lL. The cycling profile for the
TABLE 1. Tamarin species analyzed in the present study and the GenBank accession numbers for the sequences obtained
Species
Number of
specimens
Specimen
code Origin
GenBank number for the locus:
SagF3 Sag39 Sag132 SagC3 SagF7
S. fuscicollis 2 77 Rondonia, Brazil JF489218 JF489158 JF489172 JF489203 JF489188
78 JF489219 JF489159 JF489173 JF489204 JF489189
S. mystax 2 5082 Iquitos, Peru JF489230 JF489168 JF48918 JF489214 JF489199
5086 JF489231 JF489169 JF489185 JF489215 JF489200
S. labiatus 1 02 Genbank AY620486 AY620649 AY620641 AY620678 *
S. imperator 2 3 Unknowna JF489220 – JF48917 JF489205 JF489190
5 JF489221 – JF489175 JF489206 JF489191
S. midas 1 34 Unknowna JF489226 JF489164 JF489180 JF489210 JF489195
S. midas 1 2088 Amapa, Brazil JF489227 JF489165 JF489181 JF489211 JF489196
S. niger 2 1278 Para, Brazil JF489228 JF489166 JF489182 JF489212 JF489197
1793 JF489229 JF489167 JF489183 JF489213 JF489198
S. bicolor 1 932 Amazonas, Brazilb JF489217 JF489158 JF489171 JF489202 JF489187
S. martinsi 1 1069 Amazonas, Brazilb JF489225 – JF489179 JF489209 DQ000000
S. oedipus 1 125 Cali, Colombia JF489232 JF489170 JF489186 JF489216 JF489201
S. leucopus 1 S02 Cali, Colombia JF489224 JF489163 JF489178 – JF489194
S. inustus 2 705/734 Amana˜, Amazonas,
Brazil
JF489222 JF48916 JF489176 JF489207 JF489192
JF489223 JF489162 JF489177 JF489208 JF489193
a Samples provided by the Brazilian National Primate Center in Ananindeua, Para´ (CENP).
b Samples provided by the Rio de Janeiro Primate Center (CPRJ). The remaining samples were obtained from wild-caught animals.
–: not sequenced; *: sequence not deposited in genebank. It was available as supplementary data in http://batzerlab. lsu.edu/
pub2005.html#04
2 D.B. DA CUNHA ET AL.
American Journal of Physical Anthropology
amplifications was almost the same for the five loci: 948C
for 3 min followed by 30 cycles at 948C for 1 min, anneal-
ing temperature varying from 59 to 658C for 1 min,
depending on the primer (Table 2), followed by a final
extension of 728C for 10 min. The samples were electro-
phoresed in a 1.2% agarose gel to verify the PCR product.
The products were purified by the ExoSap IT treatment
(Amersham-Pharmacia Biotech.), and then submitted to a
cycle-sequencing reaction using the fluorescent-labeled
dideoxy terminators supplied with the ABI PrismTM Dye
Terminator Cycle Sequencing Ready Reaction kit (Applied
Biosystems, Foster City, CA). Sequencing reactions were
performed in a 10 lL volume containing 2 lL of DNA,
0.5 (1 mM) of primer, 2 lL of BigDye mix, 3 lL of buffer
(200 mM Tris/5 mM MgCl2), and 2.5 lL of autoclaved
double distilled water, using a cycling profile of 25 cycles
at 968C for 30 sec, 508C for 15 sec and 608C for 1 min.
Unincorporated di-deoxynucleotides were removed by
isopropanol washing according to the method recom-
mended in the ABI manual. The products were separated
by electrophoresis (3 h at 3,000 V) and the sequences
read in an ABI Prism 3130 automated sequencer.
All the sequences were aligned using the ClustalW
program (Thompson et al., 1994) with default parame-
ters. Minor modifications were made by eye using the
BioEdit sequence editor (Hall, 1999). Nucleotide satura-
tion was assessed by plotting transitions and transver-
sions against uncorrected p-distances using the DAMBE
program, version 4.0.65 (Xia and Xie, 2001).
As the number of base pairs of each marker varied
from 347 to 693 (which is relatively small for nuclear
sequences) and a relatively large number of taxa were
examined, the separate phylogenetic analysis of each
marker generated a large number of equally parsimoni-
ous trees with low support values for most nodes. It was
thus impossible to use the partition homogeneity test of
Farris et al. (1995) for the assessment of the homogene-
ity of the phylogenetic signal across loci. In this case, we
decided to concatenate the data from the five loci and
conducted all additional analyses using the concatenated
data set.
Genetic distances were estimated in PAUP* using
either an uncorrected (‘‘p’’) distance matrix or maximum
likelihood procedure using a ‘‘paupblock’’ built in jMo-
deltest (Posada, 2008). Phylogenetic reconstructions
were conducted using PAUP*, version 4.0b10 (Swofford,
2003) for maximum parsimony (MP) (branch and bound
searches were conducted in all MP analyses), neighbor
joining (NJ), and maximum likelihood (ML) analysis.
Gaps were treated as missing data in all analyses.
A Bayesian phylogenetic analysis was implemented
using MrBayes 3.1.2 (Huelsenbeck and Ronquist, 2001).
Metropolis-coupled Markov chain Monte Carlo
(MCMCMC) sampling was performed with four chains
that were run for 10,000,000 generations, using model
parameters for each partition selected by Kakuzan (ver-
sion 4), a script written in the Perl language (Tanabe,
2007), using the AIC criterion (Posada and Buckley,
2004). Bayesian posterior probabilities were selected
from the 50% majority rule consensus of trees sampled
every 20 generations after removing trees obtained
before the chains reached apparent stationarity (burn-in
determined by empirical checking of likelihood values).
The BEAST software (Drummond and Rambaut, 2007)
was used to estimate divergence times among the sam-
ple taxa. For the analysis, we used a relaxed uncorre-
lated lognormal clock model of lineage variation, and for
branching rates a prior Yule process was assumed. Anal-
yses were run for 20,000,000 generations, with tree and
parameter sampling occurring every 1,000 generations,
of which 10% were discarded as burn-in. The adequacy
of a 10% burn-in and convergence of all parameters was
assessed by visual inspection of the trace of the parame-
ters across generations. Subsequently, the sampling dis-
tributions of multiple independent replicates were com-
bined using the software, and then summarized and
visualized using the TreeAnnotator v1.4.6 software,
which is part of the BEAST package (Drummond and
Rambaut, 2007). For the platyrrhine calibration point,
we used the split between Saimiri and Cebus, with an
upper limit of 22 mya, obtained from previous studies
(Schneider, 2000; Opazo et al., 2006) centered on Doli-
chocebus (20 mya), which is probablythe crown taxon of
the Saimiri lineage (Slazay and Delson, 1979). For the
emergence of the Saguinus clade, we used Opazo et al.’s
(2006) estimate of 15 mya.
The reliability of the ML, NJ, and MP nodes was
estimated using 1,000 bootstrap pseudo-replicates
(Felsenstein, 1985) and heuristic searches. All trees were
rendered using Figtree (a graphical viewer of phyloge-
netic trees tool; available in http://tree.bio.ed.ac.uk/soft
ware/figtree/).
RESULTS
The five concatenated loci generated a combined
sequence of 2,493 nucleotides with 231 variable sites, of
which only 146 were informative for parsimony analysis.
No saturation was detected and the score of the most
parsimonious tree was 280. The phylogenetic trees
generated by the MP, ML, and NJ analyses and the
Bayesian Inference (BI) procedures all produced similar
topologies, with the principal differences lying in the
magnitude of the support for the nodes provided by
TABLE 2. Primers used for the sequencing of the genomic regions analyzed in the present study (obtained from Ray et al., 2005)
C. jacchus Primer sequence:
Locus CHRa Forwardb Reverseb Temp. (8C)
SagSF7 X GAGTCTCACAGCCCTCCAAG TGAATCTAACACCTCTGAATGTAGGC 65
SagF3 19 GTCACTGAAACTGCACTCAGGG GCAGTGCCCTTGAACCTGGCA 65
Sag132a 8 TGGATGTCTCACAGCTCCAA TTGATGYCCTTCCCCAAGAC 63
SagC3 2 GGACTCTTTGACATGGTCTTTCTC CTTCTTTATCACATCAGAGTGAGC 65
Sag39 6 TGAAGAGAAGCTCATTTGTGAG ATGGGCAACCAACACTCYGT 59
a CHR 5 chromosomes identified by blasting against C. jacchus genome (http://www.ncbi.nlm.nih.gov/genome/seq/BlastGen/
BlastGen.cgi?taxid59483).
b Obtained from Ray et al. (2005)— http://batzerlab.lsu.edu/pub2005.html#04—Supplementary_Table_MPE_8_11_04.
Temp. 5 Annealing temperature.
3PHYLOGENY OF Saguinus BASED ON Alu INSERTIONS
American Journal of Physical Anthropology
bootstrap (BS) and posterior probability (PP) analyses. A
maximum likelihood tree is presented in Figure 1 with
numbers at the branches representing bootstrap percen-
tages or Bayesian posterior probabilities percentages for
ML, Bayesian analysis, NJ, and MP, respectively.
The polytomic topology of this tree presents four
lineages formed by: (i) S. fuscicollis, representing the
small-bodied (nigricollis) group; (ii) S. mystax alone; (iii)
S. labiatus, S. imperator, together with the mottled-faced
S. inustus, faintly supported; and (iv) the Colombian
tamarins (S. oedipus, S. leucopus) together with the
S. midas/S. bicolor clade. These four lineages are rela-
tively supported by all analysis.
While the latter arrangement links the two groups of
bare-face tamarins (S. oedipus/S. leucopus and S.
bicolor/S. martinsi), it is not strongly supported by all
methods (bootstrap percentages varied from 60 to 81%,
while Bayesian posterior probabilities was of 100% (see
Fig. 1). By contrast, the S. bicolor/S. martinsi clade is
unequivocally the sister group of the geographically
adjacent S. midas/S. niger clade, with highly significant
bootstrap values (94–97%) and posterior probability of
100% (see Fig. 1). The internal relationships of the
S. midas/S. niger clade were not resolved in the present
analysis, however. On the other hand, S. oedipus and
S. leucopus were closely related, with highly significant
bootstrap values (88–100%) and posterior probabilities
(100%). Conversely, in the mustached group, the internal
relationships were completely unresolved. Even the rela-
tionship of S. labiatus with S. inustus or S. imperator
was uncertain.
Genetic (p) distances varied from 0% between some
pairs of conspecifics to 7.4% between the Colombian tam-
arins and Saimiri (Table 3). In the case of S. midas and
S. niger, intra- and interspecific distances were almost
indistinguishable (0.2–0.3%), reflecting the unresolved
relationship between these species (see Fig. 1). With the
exception of S. imperator, all other distances between
conspecifics were zero. The value recorded for S. impera-
tor (P 5 0.1%) is perhaps the most surprising here. In
the present study, the lowest between-species distances
were recorded between S. midas and S. niger (0.3%),
while distances were highest between pairs including
S. fuscicollis, with values of between 2.4% and 3.3% (the
latter for S. fuscicollis vs. S. labiatus).
Figure 2 presents estimates of divergence times. The
three-way split (relationships unresolved) of mustached
tamarins, oedipus-leucopus and midas-bicolor was
estimated at 12.5 mya, while the midas-bicolor group
was estimated at 5 mya, similar to the separation
between S. oedipus and S. leucopus.
DISCUSSION
Despite being somewhat preliminary, due to the rela-
tively small number of both taxa and samples analyzed,
the results of the present study provide an alternative,
and potentially important molecular perspective on the
phylogeny of the Saguinus tamarins based on nuclear
DNA markers. In common with all other recent molecu-
lar and morphological studies (Natori and Hanihara,
1992; Rylands et al., 1993; Meireles et al., 1997; Cropp
et al., 1999; Tagliaro et al., 2005; Araripe et al.,
2008), the results of the present analysis further empha-
size the inadequacies of Hershkovitz’s (1977) classic
arrangement based on facial pelage and pigmentation
patterns. In particular, our results support a sister rela-
tionship between some bare- (S. bicolor/S. martinsi) and
hairy-faced (S. midas/S. niger) tamarins, which is
inconsistent with Hershkovitz’s scheme but might be
Fig. 1. Topology of a maximum likelihood tree for eleven Saguinus species based on the concatenated alignment of 2493 base
pairs from five nuclear DNA regions containing Alu insertions. Evolutionary history was inferred using maximum likelihood (ML)
Bayesian Inference, neighbor joining (NJ), and maximum parsimony methods. At each node, the percentage of replicate trees in
which the cluster was defined using the bootstrap test (1000 replicates) or posterior probabilities is given for the ML, BI, NJ, and
MP methods, respectively. Zero (0) means no support 5 unresolved; Star (*) means that S. labiatus grouped with S. imperator or
appears in an unresolved polytomy; Two stars (**) means that S. fuscicollis emerges as the most basal to the Saguinus group in the
distance analysis (NJ).
4 D.B. DA CUNHA ET AL.
American Journal of Physical Anthropology
predicted by their geographic proximity in the northern
Amazon basin.
While this corroborates the findings of our previous
studies using the mitochondrial ND1 (Tagliaro et al.,
2005) and rRNA16S genes (Araripe et al., 2008), poten-
tially meaningful differences were also recorded. In par-
ticular, while S. leucopus was clearly differentiated from
the other Colombian tamarins in these previous studies,
it was very clearly allied with S. oedipus here, as would
be expected according to the geographic proximity of
their ranges in northwestern Colombia, which are sepa-
rated from those of all other tamarins (except Saguinus
geoffroyi, which was not included here) by the Andes
(Rylands et al., 1993). In this case, then, the analysis
of the genome sequences including Alu insertions
appeared to be consistent with the presumed phyloge-
netic relationship between the species, based on their
morphological similarities and present-day distribution
(Hershkovitz, 1977; Moore and Cheverud, 1992; Natori
and Hanihara, 1992; Jacobs et al., 1995).
By contrast, whereas the mitochondrial data (Tagliaro
et al., 2005; Araripe et al., 2008) provided relatively con-
clusive evidence on the phylogenetic relationships of the
mustached tamarin group (S. imperator, S. labiatus, and
TABLE 3. Estimates of Evolutionary Divergence (uncorrected p-distances in percentages) between the concatenated sequences of five
nuclear DNA regions containing Alu insertions
Species Cap Sai Sfu Sfu Sim Sim Sla Smy Smy Sin Sin Soe Sle Sma Smi Smi Sni Sni
Saimiri 5.72
S. fuscicollis 4052 5.02 6.38
S. fuscicollis 4055 5.02 6.38 0.00
S.imperator 3 5.89 6.42 2.85 2.85
S. imperator 5 5.79 6.32 2.73 2.73 0.10
S. labiatus 5.67 6.31 3.30 3.30 1.86 1.76
S. mystax 5082 5.19 6.00 2.68 2.68 1.86 1.75 1.34
S. mystax 5086 5.19 6.00 2.68 2.68 1.86 1.75 1.34 0.00
S. inustus 705 5.23 5.94 2.88 2.88 2.12 2.01 1.37 1.36 1.36
S. inustus 734 5.34 6.04 2.93 2.93 2.17 2.07 1.32 1.41 1.41 0.04
S. oedipus 5.79 7.43 2.95 3.00 3.03 2.92 2.74 2.16 2.16 2.30 2.35
S. leucopus 5.15 7.37 2.56 2.56 2.65 2.51 2.60 1.81 1.81 1.73 1.79 0.90
S. martinsi 5.09 6.83 2.36 2.36 2.36 2.21 2.14 1.27 1.27 2.07 2.07 2.00 1.43
S. midas 34 5.69 6.43 3.05 3.05 2.79 2.74 1.97 1.33 1.33 1.66 1.71 1.96 1.68 0.45
S. midas 2088 5.85 6.58 2.95 2.95 2.79 2.69 2.18 1.52 1.52 1.89 1.93 1.91 1.63 0.52 0.29
S. niger 1278 5.39 6.98 2.84 2.84 2.91 2.85 2.25 1.40 1.40 1.93 1.98 1.95 1.80 0.20 0.32 0.32
S. niger 1793 5.39 6.97 2.69 2.69 2.81 2.75 2.21 1.34 1.34 1.79 1.84 1.75 1.57 0.52 0.27 0.27 0.23
S. bicolor 5.92 6.67 2.92 2.92 2.72 2.62 2.36 1.74 1.74 1.89 1.93 1.97 1.60 0.30 0.97 1.02 1.12 0.98
Cap 5 Cebus apella; Sai 5 Saimiri sciureus; Sfu 5 Saguinus fuscicollis; Sim 5 S. imperator; Sla 5 S. labiatus; Smy 5 S. mystax;
Sin 5 S. inustus; Soe 5 S. oedipus; Sle 5 S. leucopus; Sma 5 S. martinsi; Smi 5 S. midas; Sni 5 S. niger.
Fig. 2. Chronogram deduced from the Bayesian analysis and a time scale as inferred from a Bayesian relaxed molecular clock
approach based on five combined loci.
5PHYLOGENY OF Saguinus BASED ON Alu INSERTIONS
American Journal of Physical Anthropology
S. mystax), as well as the midas group (S. midas and
S. niger), the present study was inconclusive. These dif-
ferences may be related in part to the relatively conserv-
ative characteristics of nuclear DNA in comparison with
the more rapidly evolving mitochondrial DNA (Brown et
al., 1979) or due to past hybridization events leading to
reticulate evolution as proposed by Arnold (2009) and
Arnold and Meyer (2006). An additional factor may be
the rapid adaptive radiation in the evolutionary history
of these tamarins, which has resulted in relatively short
branch lengths separating the taxa, which are less easily
interpreted. The overall inconclusiveness and contradic-
tory findings of the combined analysis of mitochondrial
(Tagliaro et al., 2005; Araripe et al., 2008) and nuclear
loci (present study) suggest that the phylogenetic rela-
tionships of these tamarins may be difficult to interpret
definitively, whatever the molecular markers used. This
difficulty may be related to the dynamic nature of the
region, characterized by the occurrence of major geomor-
phological processes over relatively short periods of time
(Mapes et al., 2004; Rossetti et al., 2005; Mapes, 2009),
which appear to have resulted in short bursts of evolu-
tionary change in the tamarins, interspersed with long
periods of stability. The most significant event here
would have been the Pleistocene–Holocene formation of
the present-day river systems, which have played a
prominent role in the radiation and speciation of the pla-
tyrrhines, in particular the small-bodied forms such as
the tamarins (Ayres and Clutton-Brock, 1992; Ferrari,
2004). The phylogenetic relationships produced by proc-
esses of this type may be especially difficult to interpret
using the available quantitative approaches. In conclu-
sion, the results of the present work suggest that the Co-
lombian S. leucopus and S. oedipus may have shared a
recent common ancestor. Moreover, the results also sug-
gest that they are as closely related, as are the species of
bicolor-midas group. Interestingly, divergence time esti-
mates suggest that the speciation within these two
related groups may have occurred at almost the same
time, probably at the Pleistocene–Holocene boundary.
We hope that with the advance of the technology of
whole genome sequencing and more whole genome of
primates available, more information nuclear marker
and SNPs, coupled with a better understanding of the
geological phenomena that took place in the western
Amazonia in the last 20 million years will provide more
valuable information for clarifying the phylogenetic
history of these creatures in the New World.
LITERATURE CITED
Araripe J, Tagliaro CH, Rego PS, Sampaio I, Ferrari SF, Schnei-
der H. 2008. Molecular phylogenetics of large-bodied tamar-
ins, Saguinus spp. (Primates, Platyrrhini). Zool Scripta
37:461–467.
Arnold ML. 2009. Reticulate evolution and humans. Oxford:
Oxford University Press.
Arnold ML, Meyer A. 2006. Natural hybridization in primates:
one evolutionary mechanism. Zoology 109:261–276.
Ayres JM, Clutton-Brock TH. 1992. River boundaries and
species range size in Amazonian primates. Am Nat 140:531–
537.
Batzer MA, Deininger PL. 2002. Alu repeats and human
genomic diversity. Nat Rev Genet 3:370–379.
Brown WM, George M, Wilson AC. 1979. Rapid evolution of
animal mitochondrial DNA. Proc Natl Acad Sci USA 76:1967–
1971.
Canavez FC, Moreira MAM, Simon F, Parham P, Seuanez HN.
1999. Phylogenetic relationships of the callitrichinae (Platyr-
rhini, Primates) based on b2-microglobulin DNA sequences.
Am J Primatol 48:225–236.
Cropp SJ, Larson A, Cheverud JM. 1999. Historical biogeogra-
phy of tamarins, genus Saguinus: the molecular phylogenetic
evidence. Am J Phys Anthropol 108:65–89.
Drummond A, Rambaut A. 2007. BEAST: Bayesian evolutionary
analysis by sampling trees. BMC Evol Biol 7:214.
Farris JS, Kallersjo M, Kluge AG, Bult CJ. 1995. Constructing
a significance test for incongruence. Syst Biol 44:570–572.
Felsenstein J. 1985. Confidence limits on phylogenies: an
approach using the bootstrap. Evolution 39:783–791.
Ferrari SF 2004. Biogeography of Amazonian primates. In: Chiar-
ello AG and Mendes SL, editors. A Primatologia no Brasil—8.
Santa Teresa: Sociedade Brasileira de Primatologia. p 101–122.
Hall TA. 1999. BioEdit: a user-friendly biological sequence
alignment editor and analysis program for Windows 95/98/NT.
Nucl Acids Symp Ser 41:95–98.
Hamdi H, Nishio H, Zielinski R, Dugaiczyk A. 1999. Origin and
phylogenetic distribution of Alu DNA repeats: irreversible
events in the evolution of primates. J Mol Biol 289:861–871.
Hershkovitz P. 1977. Living New World monkeys (Platyrrhini),
with an introduction to primates. Chicago: University of Chi-
cago Press.
Hillis DM. 1999. SINEs of the perfect character. Proc Natl Acad
Sci USA 96:9979–9981.
Huelsenbeck JP, Ronquist F. 2001. MRBAYES: Bayesian infer-
ence of phylogenetic trees. Bioinformatics 17:754–755.
Jacobs SC, Larson A, Cheverud JM. 1995. Phylogenetic relation-
ships and orthogenetic evolution of coat color among tamarins
(Genus Saguinus). Syst Biol 44:515–532.
Mapes RW. 2009. Past and present provenance of the Amazon
River drainage basin. (Ph.D. Thesis): University of North
Carolina.
Mapes RW, Coleman DS, Nogueira ACR, Housh TB. 2004. How
far do zircons travel? Evaluating the significance of detrital
zircon provenance using the modern Amazon River fluvial
system. Geological Society of America Abstracts with Pro-
grams, Vol. 36, p 78.
Matauschek C, Roos C, Heymann EW. 2011. Mitochondrial phy-
logeny of tamarins (Saguinus. Hoffmannsegg 1807) with taxo-
nomic and biogeographic implications for the S. nigricollis
species group. Am J Phys Anthropol 144:564–574.
Meireles C, Sampaio I, Schneider H, Ferrari SF, Coimbra AF,
Pissinatti A, Schneider MPC. 1997. A comparative study of
eleven protein systems in tamarins, genus Saguinus (Platyr-
rhini, Callitrichinae). Brazil J Genet 20:13–19.
Miyamoto MM. 1999. Molecular systematics: perfect SINES of
evolutionary history? Curr Biol 9:816–819.
Moore AJ, Cheverud JM. 1992. Systematics of the Saguinus
oedipus group of the bare-face tamarins: evidence from facial
morphology. Am J Phys Anthropol 89:73–84.
Natori M, Hanihara T. 1992. Variations in dental measurements
between Saguinus species and their systematic relationships.
FoliaPrimatologica 58:84–92.
Opazo JC, Wildman DE, Prychitko T, Johnson RM, Goodman
M. 2006. Phylogenetic relationships and divergence times
among New World monkeys (Platyrrhini, Primates). Mol Phyl-
ogen Evol 40:274–280.
Posada D. 2008. jModelTest: phylogenetic model averaging. Mol
Biol Evol 25:1253–1256.
Posada D, Buckley TR. 2004. Model selection and model averag-
ing in phylogenetics: advantages of akaike information crite-
rion and bayesian approaches over likelihood ratio tests. Syst
Biol 53:793–808.
Ray DA, Xing J, Hedges DJ, Hall MA, Laborde ME, Anders BA,
White BR, Stoilova N, Fowlkes JD, Landry KE, Chemnick
LG, Ryder OA, Batzer MA. 2005. Alu insertion loci and
platyrrhine primate phylogeny. Mol Phylogen Evol 35:117–
126.
Rossetti DF, Mann de Toledo PM, Goes AM. 2005. New geologi-
cal framework for Western Amazonia (Brazil) and implica-
tions for biogeography and evolution. Quat Res 63:78–89.
6 D.B. DA CUNHA ET AL.
American Journal of Physical Anthropology
Roy-Engel AM, Carroll ML, El-Sawy M, Salem AH, Garber RK,
Nguyen SV, Deininger P, MA B. 2002. Non-traditional Alu evo-
lution and primate genomic diversity. J Mol Biol 316:1033–1040.
Rylands AB, Coimbra-Filho AF, Mittermeier RA. 1993. System-
atics, geographic distribution, and some notes on the conser-
vation status of the Callitrichidae. In: Rylands AB, editor.
Marmosets and tamarins: systematics, behaviour, and ecology.
Oxford: Oxford University Press. p 11–77.
Rylands AB, Schneider H, Langguth A, Mittermeier RA, Groves
CP, Rodrı´guez-Luna E. 2000. An assessment of the diversity
of New World primates. Neotrop Primates 8:61–93.
Sambrook J, Fritsch EF, and Maniatis T. 1989. Molecular clon-
ing: a laboratory manual. Cold Spring Harbor, NY: Cold
Spring Harbor Laboratory.
Schneider H. 2000. The current status of the New World mon-
key phylogeny. An Acad Bras Cienc 72:165–172.
Shedlock A, Okada N. 2000. SINE insertions: powerful tools for
molecular systematic. Bioessayes 22:148–160.
Slazay FS, and Delson E. 1979. Evolutionary history of the
primates. New York: Academic Press.
Swofford DL. 2003. PAUP*:Phylogenetic Analysis Using Parsi-
mony (*and other Methods). 4.0b10 ed. Sunderland, MA:
Sinauer Associates.
Tagliaro CH, Schneider H, Sampaio I, Schneider MPC, Vallinoto
M, Stanhope M. 2005. Molecular phylogeny of the genus
Saguinus (Platyrrhini, Primates) based on the ND1 mitochon-
drial gene and implications for conservation. Genet Mol Biol
28:46–53.
Tanabe AS. 2007. kakusan: a computer program to automate
the selection of a nucleotide substitution model and the con-
figuration of a mixed model on multilocus data. Mol Ecol
Notes 7:962–964.
Thompson JD, Higgins DG, Gibson TJ. 1994. CLUSTAL W:
improving the sensitivity of progressive multiple sequence
alignment through sequence weighting, position-specific gap
penalties and weight matrix choice. Nucl Acids Res 22:4673–
4680.
Xia X, Xie Z. 2001. DAMBE: data analysis in molecular biology
and evolution. J Hered 92:371–373.
7PHYLOGENY OF Saguinus BASED ON Alu INSERTIONS
American Journal of Physical Anthropology