A maior rede de estudos do Brasil

Grátis
11 pág.
AULA PRATICA DE BIOINFORMÁTICA

Pré-visualização | Página 1 de 2

AULA PRATICA DE BIOINFORMÁTICA
CURSO BIOMEDICINA
UNIVERSIDADE DE MOGI DAS CRUZES
INTRODUÇÃO Á BIOINFORMATICA
A Bioinformática é a união da Biologia e da Computação envolvendo diversas linhas do conhecimento, tais como: biologia molecular, matemática, estatística, engenharia de softwares e ciência da computação. A Bioinformática gera diversos softwares e modelos que auxiliam o estudo e analise de dados moleculares. Segue um roteiro de tarefas para o conhecimento de algumas ferramentas de estudos moleculares insilicos.
NATIONAL CENTER FOR BIOTECHNOLOGY INFORMATION
http://www.ncbi.nlm.nih.gov/
About NCBl – apresentação do site.
TaxBrowser – verificar a classificação taxonômica de um organismo.
ORF Finder – ferramenta utilizada para identificar possíveis genes em uma seqüência desconhecida.
Blast – (Basic Local Alignment Search Tool) verificar a similaridade de uma seqüência de interesse com seqüências depositadas no banco de dados GenBank. Seguem exemplos.
Na “homepage” do NCBI clicar em BLAST. Surgirá tela do BLAST, onde devem clicar em “nucleotide BLAST” (Basic BLAST). Colar seqüência de interesse no campo “Enter Query Sequence”. Escolher a base de dados (Choose Search Set). Clicar no botão BLAST. Surgirá nova janela com resultados apresentando as seqüências mais similares do banco de dados.
Fazer um BLAST digitando uma seqüência aleatória de 20 nucleotídeos. Provavelmente haverá baixa similaridade de seqüências, o que indica que a seqüência dos nucleotídeos no DNA não é aleatória.
	
Fazer um BLAST com a sequência abaixo, usando a base de dado do Genoma Humano (Human Genome + transcript).
	
GAGAGTGTTGGCCTCTTGCTCTCCGGCTCCCTCTGTTGCCCTCTGGTTTCTCCCCAGGCTCCCGGACGTC
CCTGCTCCTGGCTTTTGGCCTGCTCTGCCTGCCCTGGCTTCAAGAGGGCAGTGCCTTCCCAACCATTCCC
TTATCCAGGCTTTTTGACAACGCTATGCTCCGCGCCCATCGTCTGCACCAGCTGGCCTTTGACACCTACC
Clicar em “GenomeViewer” para descobrir em qual cromossomo e posição se encontra a seqüência analisada.
Observar a seqüência completa do gene.
Descobrir a função do gene.
O GH (growth hormone) também chamado de somatotropina é uma proteína e um hormônio peptídico sintetizado e secretado pela glândula hipófise anterior, localizados no lócus do hormônio do crescimento no cromossomo 17.
IDENTIFICAÇÃO DE POSSÍVEIS GENES. 
Clicar em Orf Finder (http://www.ncbi.nlm.nih.gov/gorf/gorf.html). 
Colocar a seqüência abaixo no campo 
Clicar em Orf Finder.
Clicar sobre as possíveis ORFs
CAGCATGTGTGGGAGGAGCTTCTAAATTATCCATTAGCACAAGCCCGTCAGTGGCCCCATGCATAAATGTAGCACAGAAACAGGTGGGGTCAACAGTGGGAGAGAAGGGGCCAGGGTATAAAAAGGGCCCACAAGAGACCAGCTCAAGGATCCCAAGGCCCAACTCCCCGAACCACTCAGGGTCCTGTGGACAGCTCACCTAGCTGCAATGGCTACAGGTAAGCGCCCCTAAAATCCCTTTGGCACAATGTGTCCTGAGGGGAGAGGCAGCGACCTGTAGATGGGACGGGGGCACTAACCCTCAGGGTTTGGGGTTCTGAATGTGAGTATCGCCATCTAAGCCCAGTATTTGGCCAATCTCAGAAAGCTCCTGGCTCCCTGGAGGATGGAGAGAGAAAAACAAACAGCTCCTGGAGCAGGGAGAGTGTTGGCCTCTTGCTCTCCGGCTCCCTCTGTTGCCCTCTGGTTTCTCCCCAGGCTCCCGGACGTCCCTGCTCCTGGCTTTTGGCCTGCTCTGCCTGCCCTGGCTTCAAGAGGGCAGTGCCTTCCCAACCATTCCCTTATCCAGGCTTTTTGACAACGCTATGCTCCGCGCCCATCGTCTGCACCAGCTGGCCTTTGACACCTACCAGGAGTTTGTAAGCTCTTGGGGAATGGGTGCGCATCAGGGGTGGCAGGAAGGGGTGACTTTCCCCCGCTGGAAATAAGAGGAGGAGACTAAGGAGCTCAGGGTTTTTCCCGACCGCGAAAATGCAGGCAGATGAGCACACGCTGAGCTAGGTTCCCAGAAAAGTAAAATGGGAGCAGGTCTCAGCTCAGACCTTGGTGGGCGGTCCTTCTCCTAGGAAGAAGCCTATATCCCAAAGGAACAGAAGTATTCATTCCTGCAGAACCCCCAGACCTCCCTCTGTTTCTCAGAGTCTATTCCGACACCCTCCAACAGGGAGGAAACACAACAGAAATCCGTGAGTGGATGCCTTCTCCCCAGGCGGGGATGGGGGAGACCTGTAGTCAGAGCCCCCGGGCAGCACAGCCAATGCCCGTCCTTGCCCCTGCAGAACCTAGAGCTGCTCCGCATCTCCCTGCTGCTCATCCAGTCGTGGCTGGAGCCCGTGCAGTTCCTCAGGAGTGTCTTCGCCAACAGCCTGGTGTACGGCGCCTCTGACAGCAACGTCTATGACCTCCTAAAGGACCTAGAGGAAGGCATCCAAACGCTGATGGGGGTGAGGGTGGCGCCAGGGGTCCCCAATCCTGGAGCCCCACTGACTTTGAGAGACTGTGTTAGAGAAACACTGGCTGCCCTCTTTTTAGCAGTCAGGCCCTGACCCAAGAGAACTCACCTTATTCTTCATTTCCCCTCGTGAATCCTCCAGGCCTTTCTCTACACTGAAGGGGAGGGAGGAAAATGAATGAATGAGAAAGGGAGGGAACAGTACCCAAGCGCTTGGCCTCTCCTTCTCTTCCTTCACTTTGCAGAGGCTGGAAGATGGCAGCCCCCGGACTGGGCAGATCTTCAAGCAGACCTACAGCAAGTTCGACACAAACTCACACAACGATGACGCACTACTCAAGAACTACGGGCTGCTCTACTGCTTCAGGAAGGACATGGACAAGGTCGAGACATTCCTGCGCATCGTGCAGTGCCGCTCTGTGGAGGGCAGCTGTGGCTTCTAGCTGCCCGGGTGGCATCCCTGTGACCCCTCCCCAGTGCCTCTCCTGGCCCTGGAAGTTGCCACTCCAGTGCCCACCAGCCTTGTCCTAATAAAATTAAGTTGCATCATTTTGTCTGACTAGGTGTCCTTCTATAATATTATGGGGTG
IDENTIFICAÇÃO DO GENE. 
Marcar CDS (Região codificadora / Sequência codificadora / OFR (Open reading frame) ou fase aberta de leitura)
CAGCATGTGTGGGAGGAGCTTCTAAATTATCCATTAGCACAAGCCCGTCAGTGGCCCCATGCATAAATGTAGCACAGAAACAGGTGGGGTCAACAGTGGGAGAGAAGGGGCCAGGGTATAAAAAGGGCCCACAAGAGACCAGCTCAAGGATCCCAAGGCCCAACTCCCCGAACCACTCAGGGTCCTGTGGACAGCTCACCTAGCTGCAATGGCTACAGGTAAGCGCCCCTAAAATCCCTTTGGCACAATGTGTCCTGAGGGGAGAGGCAGCGACCTGTAGATGGGACGGGGGCACTAACCCTCAGGGTTTGGGGTTCTGAATGTGAGTATCGCCATCTAAGCCCAGTATTTGGCCAATCTCAGAAAGCTCCTGGCTCCCTGGAGGATGGAGAGAGAAAAACAAACAGCTCCTGGAGCAGGGAGAGTGTTGGCCTCTTGCTCTCCGGCTCCCTCTGTTGCCCTCTGGTTTCTCCCCAGGCTCCCGGACGTCCCTGCTCCTGGCTTTTGGCCTGCTCTGCCTGCCCTGGCTTCAAGAGGGCAGTGCCTTCCCAACCATTCCCTTATCCAGGCTTTTTGACAACGCTATGCTCCGCGCCCATCGTCTGCACCAGCTGGCCTTTGACACCTACCAGGAGTTTGTAAGCTCTTGGGGAATGGGTGCGCATCAGGGGTGGCAGGAAGGGGTGACTTTCCCCCGCTGGAAATAAGAGGAGGAGACTAAGGAGCTCAGGGTTTTTCCCGACCGCGAAAATGCAGGCAGATGAGCACACGCTGAGCTAGGTTCCCAGAAAAGTAAAATGGGAGCAGGTCTCAGCTCAGACCTTGGTGGGCGGTCCTTCTCCTAGGAAGAAGCCTATATCCCAAAGGAACAGAAGTATTCATTCCTGCAGAACCCCCAGACCTCCCTCTGTTTCTCAGAGTCTATTCCGACACCCTCCAACAGGGAGGAAACACAACAGAAATCCGTGAGTGGATGCCTTCTCCCCAGGCGGGGATGGGGGAGACCTGTAGTCAGAGCCCCCGGGCAGCACAGCCAATGCCCGTCCTTGCCCCTGCAGAACCTAGAGCTGCTCCGCATCTCCCTGCTGCTCATCCAGTCGTGGCTGGAGCCCGTGCAGTTCCTCAGGAGTGTCTTCGCCAACAGCCTGGTGTACGGCGCCTCTGACAGCAACGTCTATGACCTCCTAAAGGACCTAGAGGAAGGCATCCAAACGCTGATGGGGGTGAGGGTGGCGCCAGGGGTCCCCAATCCTGGAGCCCCACTGACTTTGAGAGACTGTGTTAGAGAAACACTGGCTGCCCTCTTTTTAGCAGTCAGGCCCTGACCCAAGAGAACTCACCTTATTCTTCATTTCCCCTCGTGAATCCTCCAGGCCTTTCTCTACACTGAAGGGGAGGGAGGAAAATGAATGAATGAGAAAGGGAGGGAACAGTACCCAAGCGCTTGGCCTCTCCTTCTCTTCCTTCACTTTGCAGAGGCTGGAAGATGGCAGCCCCCGGACTGGGCAGATCTTCAAGCAGACCTACAGCAAGTTCGACACAAACTCACACAACGATGACGCACTACTCAAGAACTACGGGCTGCTCTACTGCTTCAGGAAGGACATGGACAAGGTCGAGACATTCCTGCGCATCGTGCAGTGCCGCTCTGTGGAGGGCAGCTGTGGCTTCTAGCTGCCCGGGTGGCATCCCTGTGACCCCTCCCCAGTGCCTCTCCTGGCCCTGGAAGTTGCCACTCCAGTGCCCACCAGCCTTGTCCTAATAAAATTAAGTTGCATCATTTTGTCTGACTAGGTGTCCTTCTATAATATTATGGGGTG
Marcar éxons e introns
CAGCATGTGTGGGAGGAGCTTCTAAATTATCCATTAGCACAAGCCCGTCAGTGGCCCCATGCATAAATGT
AGCACAGAAACAGGTGGGGTCAACAGTGGGAGAGAAGGGGCCAGGGTATAAAAAGGGCCCACAAGAGACC
AGCTCAAGGATCCCAAGGCCCAACTCCCCGAACCACTCAGGGTCCTGTGGACAGCTCACCTAGCTGCAAT GGCTACAGGTAAGCGCCCCTAAAATCCCTTTGGCACAATGTGTCCTGAGGGGAGAGGCAGCGACCTGTAG ATGGGACGGGGGCACTAACCCTCAGGGTTTGGGGTTCTGAATGTGAGTATCGCCATCTAAGCCCAGTATT TGGCCAATCTCAGAAAGCTCCTGGCTCCCTGGAGGATGGAGAGAGAAAAACAAACAGCTCCTGGAGCAGG GAGAGTGTTGGCCTCTTGCTCTCCGGCTCCCTCTGTTGCCCTCTGGTTTCTCCCCAGGCTCCCGGACGTC CCTGCTCCTGGCTTTTGGCCTGCTCTGCCTGCCCTGGCTTCAAGAGGGCAGTGCCTTCCCAACCATTCCC TTATCCAGGCTTTTTGACAACGCTATGCTCCGCGCCCATCGTCTGCACCAGCTGGCCTTTGACACCTACC AGGAGTTTGTAAGCTCTTGGGGAATGGGTGCGCATCAGGGGTGGCAGGAAGGGGTGACTTTCCCCCGCTG GAAATAAGAGGAGGAGACTAAGGAGCTCAGGGTTTTTCCCGACCGCGAAAATGCAGGCAGATGAGCACAC GCTGAGCTAGGTTCCCAGAAAAGTAAAATGGGAGCAGGTCTCAGCTCAGACCTTGGTGGGCGGTCCTTCT CCTAGGAAGAAGCCTATATCCCAAAGGAACAGAAGTATTCATTCCTGCAGAACCCCCAGACCTCCCTCTG TTTCTCAGAGTCTATTCCGACACCCTCCAACAGGGAGGAAACACAACAGAAATCCGTGAGTGGATGCCTT CTCCCCAGGCGGGGATGGGGGAGACCTGTAGTCAGAGCCCCCGGGCAGCACAGCCAATGCCCGTCCTTGC CCCTGCAGAACCTAGAGCTGCTCCGCATCTCCCTGCTGCTCATCCAGTCGTGGCTGGAGCCCGTGCAGTT CCTCAGGAGTGTCTTCGCCAACAGCCTGGTGTACGGCGCCTCTGACAGCAACGTCTATGACCTCCTAAAG GACCTAGAGGAAGGCATCCAAACGCTGATGGGGGTGAGGGTGGCGCCAGGGGTCCCCAATCCTGGAGCCC CACTGACTTTGAGAGACTGTGTTAGAGAAACACTGGCTGCCCTCTTTTTAGCAGTCAGGCCCTGACCCAA GAGAACTCACCTTATTCTTCATTTCCCCTCGTGAATCCTCCAGGCCTTTCTCTACACTGAAGGGGAGGGA GGAAAATGAATGAATGAGAAAGGGAGGGAACAGTACCCAAGCGCTTGGCCTCTCCTTCTCTTCCTTCACT TTGCAGAGGCTGGAAGATGGCAGCCCCCGGACTGGGCAGATCTTCAAGCAGACCTACAGCAAGTTCGACA CAAACTCACACAACGATGACGCACTACTCAAGAACTACGGGCTGCTCTACTGCTTCAGGAAGGACATGGA CAAGGTCGAGACATTCCTGCGCATCGTGCAGTGCCGCTCTGTGGAGGGCAGCTGTGGCTTCTAGCTGCCC